Incidental Mutation 'R6092:Olfr883'
ID485988
Institutional Source Beutler Lab
Gene Symbol Olfr883
Ensembl Gene ENSMUSG00000094461
Gene Nameolfactory receptor 883
SynonymsGA_x6K02T2PVTD-31705144-31706073, MOR162-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6092 (G1)
Quality Score217.468
Status Validated
Chromosome9
Chromosomal Location38025808-38026737 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ATTGCTGTTT to ATTGCTGTTTGCTGTTT at 38026540 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072974]
Predicted Effect probably null
Transcript: ENSMUST00000072974
SMART Domains Protein: ENSMUSP00000072741
Gene: ENSMUSG00000094461

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.6e-48 PFAM
Pfam:7tm_1 41 288 3.7e-24 PFAM
Meta Mutation Damage Score 0.6272 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abhd16a T C 17: 35,098,810 probably null Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably null Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S859P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 H229Q probably benign Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 G134D probably benign Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 probably benign Het
Mfsd8 A G 3: 40,819,596 V493A possibly damaging Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 T2265I probably benign Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y117* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 probably benign Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T147A probably damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M195K probably benign Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Olfr883
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Olfr883 APN 9 38025811 missense probably benign 0.02
IGL02092:Olfr883 APN 9 38026621 missense possibly damaging 0.80
IGL02351:Olfr883 APN 9 38026036 missense possibly damaging 0.78
IGL02358:Olfr883 APN 9 38026036 missense possibly damaging 0.78
IGL02807:Olfr883 APN 9 38026189 missense probably damaging 1.00
R0972:Olfr883 UTSW 9 38026560 missense possibly damaging 0.88
R1016:Olfr883 UTSW 9 38026691 missense probably damaging 0.98
R1818:Olfr883 UTSW 9 38026507 missense probably damaging 1.00
R4466:Olfr883 UTSW 9 38026183 missense probably damaging 0.99
R4871:Olfr883 UTSW 9 38026526 missense probably damaging 1.00
R5977:Olfr883 UTSW 9 38026540 frame shift probably null
R5979:Olfr883 UTSW 9 38026540 frame shift probably null
R6026:Olfr883 UTSW 9 38026540 frame shift probably null
R6027:Olfr883 UTSW 9 38026540 frame shift probably null
R6029:Olfr883 UTSW 9 38026540 frame shift probably null
R6035:Olfr883 UTSW 9 38026540 frame shift probably null
R6035:Olfr883 UTSW 9 38026540 frame shift probably null
R6053:Olfr883 UTSW 9 38026541 frame shift probably null
R6106:Olfr883 UTSW 9 38026466 missense probably damaging 1.00
R6131:Olfr883 UTSW 9 38026540 frame shift probably null
R6132:Olfr883 UTSW 9 38026540 frame shift probably null
R6133:Olfr883 UTSW 9 38026540 frame shift probably null
R6134:Olfr883 UTSW 9 38026540 frame shift probably null
R6153:Olfr883 UTSW 9 38026540 frame shift probably null
R6251:Olfr883 UTSW 9 38026537 frame shift probably null
R6251:Olfr883 UTSW 9 38026545 frame shift probably null
R6251:Olfr883 UTSW 9 38026546 frame shift probably null
R6251:Olfr883 UTSW 9 38026548 frame shift probably null
R6300:Olfr883 UTSW 9 38026540 frame shift probably null
R6301:Olfr883 UTSW 9 38026540 frame shift probably null
R6305:Olfr883 UTSW 9 38026540 frame shift probably null
R6305:Olfr883 UTSW 9 38026542 frame shift probably null
R6307:Olfr883 UTSW 9 38026540 frame shift probably null
R6312:Olfr883 UTSW 9 38026540 frame shift probably null
R6312:Olfr883 UTSW 9 38026541 frame shift probably null
R6312:Olfr883 UTSW 9 38026546 frame shift probably null
R6312:Olfr883 UTSW 9 38026547 nonsense probably null
R6312:Olfr883 UTSW 9 38026549 frame shift probably null
R6813:Olfr883 UTSW 9 38025833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGACCTTCTGTGATGG -3'
(R):5'- CCTCAGAAGCCATAAGATTTTAGTTCC -3'

Sequencing Primer
(F):5'- ATCACTATGCATGTGACATACTTCC -3'
(R):5'- CCACTTAGGTAAAACTCCTTTTCATC -3'
Posted OnAug 16, 2017