Incidental Mutation 'R6092:Phf2'
ID486004
Institutional Source Beutler Lab
Gene Symbol Phf2
Ensembl Gene ENSMUSG00000038025
Gene NamePHD finger protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.427) question?
Stock #R6092 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location48801750-48871119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48816057 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 608 (D608G)
Ref Sequence ENSEMBL: ENSMUSP00000047308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035540]
Predicted Effect unknown
Transcript: ENSMUST00000035540
AA Change: D608G
SMART Domains Protein: ENSMUSP00000047308
Gene: ENSMUSG00000038025
AA Change: D608G

DomainStartEndE-ValueType
PHD 7 54 1.08e-9 SMART
JmjC 197 353 1.98e-47 SMART
low complexity region 468 481 N/A INTRINSIC
low complexity region 487 532 N/A INTRINSIC
low complexity region 884 891 N/A INTRINSIC
coiled coil region 924 948 N/A INTRINSIC
low complexity region 953 1021 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a zinc finger-like PHD (plant homeodomain) finger, distinct from other classes of zinc finger motifs, and a hydrophobic and highly conserved domain. The PHD finger shows the typical Cys4-His-Cys3 arrangement. PHD finger genes are thought to belong to a diverse group of transcriptional regulators possibly affecting eukaryotic gene expression by influencing chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased body weight, decreased adipocity and impaired adipogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abhd16a T C 17: 35,098,810 probably null Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably null Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S788P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 probably benign Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 probably benign Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 probably benign Het
Mfsd8 A G 3: 40,819,596 V493A possibly damaging Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 probably benign Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y109* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 probably benign Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T147A probably damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M195K probably benign Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Phf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Phf2 APN 13 48819607 missense unknown
IGL01554:Phf2 APN 13 48805879 nonsense probably null
IGL02063:Phf2 APN 13 48821642 missense unknown
IGL02456:Phf2 APN 13 48828846 missense unknown
IGL02498:Phf2 APN 13 48805239 missense unknown
IGL02586:Phf2 APN 13 48813858 splice site probably benign
IGL02688:Phf2 APN 13 48805839 missense unknown
H8441:Phf2 UTSW 13 48804365 missense possibly damaging 0.67
R0265:Phf2 UTSW 13 48828794 missense unknown
R0389:Phf2 UTSW 13 48804489 missense unknown
R0535:Phf2 UTSW 13 48813947 missense unknown
R1162:Phf2 UTSW 13 48819641 splice site probably benign
R1342:Phf2 UTSW 13 48804477 missense unknown
R1551:Phf2 UTSW 13 48803603 missense probably damaging 1.00
R1551:Phf2 UTSW 13 48832103 missense unknown
R1567:Phf2 UTSW 13 48832113 missense unknown
R1698:Phf2 UTSW 13 48807630 missense unknown
R1766:Phf2 UTSW 13 48819557 missense unknown
R1785:Phf2 UTSW 13 48817567 missense unknown
R1997:Phf2 UTSW 13 48828908 missense unknown
R2034:Phf2 UTSW 13 48817730 missense unknown
R2096:Phf2 UTSW 13 48832113 nonsense probably null
R2147:Phf2 UTSW 13 48804689 missense unknown
R2149:Phf2 UTSW 13 48804689 missense unknown
R2154:Phf2 UTSW 13 48820073 missense unknown
R2296:Phf2 UTSW 13 48835278 missense unknown
R4212:Phf2 UTSW 13 48820613 missense unknown
R4749:Phf2 UTSW 13 48821709 intron probably null
R4770:Phf2 UTSW 13 48803603 missense probably damaging 1.00
R4948:Phf2 UTSW 13 48807722 missense unknown
R4989:Phf2 UTSW 13 48807844 missense unknown
R5792:Phf2 UTSW 13 48820042 splice site probably null
R5848:Phf2 UTSW 13 48820070 missense unknown
R6165:Phf2 UTSW 13 48813865 critical splice donor site probably null
R6192:Phf2 UTSW 13 48820107 missense unknown
R6237:Phf2 UTSW 13 48803655 nonsense probably null
R6249:Phf2 UTSW 13 48805872 missense unknown
R6489:Phf2 UTSW 13 48826182 missense unknown
V1024:Phf2 UTSW 13 48804365 missense possibly damaging 0.67
X0027:Phf2 UTSW 13 48832118 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGGACTTCGTGCACAGTGTG -3'
(R):5'- AAGCATGCCATCGTCTCCATG -3'

Sequencing Primer
(F):5'- CACAGTGTGGGGGCACATATG -3'
(R):5'- GTGGTCCCATCTCTGGTCTG -3'
Posted On2017-08-16