Incidental Mutation 'R6092:Abhd16a'
ID486017
Institutional Source Beutler Lab
Gene Symbol Abhd16a
Ensembl Gene ENSMUSG00000007036
Gene Nameabhydrolase domain containing 16A
SynonymsD17H6S82E, Bat5, NG26
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R6092 (G1)
Quality Score174.009
Status Validated
Chromosome17
Chromosomal Location35089263-35102987 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to C at 35098810 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007251] [ENSMUST00000173846]
Predicted Effect probably null
Transcript: ENSMUST00000007251
SMART Domains Protein: ENSMUSP00000007251
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 165 179 N/A INTRINSIC
Pfam:Abhydrolase_1 280 415 6.3e-10 PFAM
Pfam:Abhydrolase_5 282 465 4.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172584
SMART Domains Protein: ENSMUSP00000133610
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
SCOP:d1imja_ 33 101 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173247
SMART Domains Protein: ENSMUSP00000134231
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
Pfam:Abhydrolase_6 2 115 8.6e-6 PFAM
Pfam:Abhydrolase_5 3 123 3.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173579
Predicted Effect
SMART Domains Protein: ENSMUSP00000133505
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably null Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S859P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 H229Q unknown Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 G134D unknown Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 unknown Het
Mfsd8 A G 3: 40,819,596 V493A possibly damaging Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 T2265I unknown Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y117* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 unknown Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T183A possibly damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M248K possibly damaging Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Abhd16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Abhd16a APN 17 35091037 missense probably damaging 0.96
IGL01943:Abhd16a APN 17 35096483 unclassified probably benign 0.00
IGL01955:Abhd16a APN 17 35101340 missense probably damaging 1.00
IGL02563:Abhd16a APN 17 35101245 missense probably damaging 1.00
R0765:Abhd16a UTSW 17 35101851 missense probably benign 0.12
R1931:Abhd16a UTSW 17 35101015 missense probably benign 0.00
R3788:Abhd16a UTSW 17 35101587 missense probably damaging 0.99
R3789:Abhd16a UTSW 17 35101587 missense probably damaging 0.99
R4567:Abhd16a UTSW 17 35096523 missense probably damaging 1.00
R4587:Abhd16a UTSW 17 35101087 critical splice donor site probably null
R4701:Abhd16a UTSW 17 35096606 critical splice donor site probably null
R4736:Abhd16a UTSW 17 35101883 missense probably benign 0.01
R4959:Abhd16a UTSW 17 35102342 missense probably benign 0.26
R4973:Abhd16a UTSW 17 35102342 missense probably benign 0.26
R5338:Abhd16a UTSW 17 35094302 missense probably damaging 1.00
R5896:Abhd16a UTSW 17 35091725 intron noncoding transcript
Predicted Primers PCR Primer
(F):5'- CAAGGGCCAAGATGAATCCCTG -3'
(R):5'- GAGTCTCTACTGCCACCTACCA -3'

Sequencing Primer
(F):5'- AAGATGAATCCCTGGGCCCTG -3'
(R):5'- ACCAGCTTCTGCCCCTGG -3'
Posted OnAug 16, 2017