Incidental Mutation 'R6092:Abhd16a'
ID486017
Institutional Source Beutler Lab
Gene Symbol Abhd16a
Ensembl Gene ENSMUSG00000007036
Gene Nameabhydrolase domain containing 16A
SynonymsD17H6S82E, Bat5, NG26
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R6092 (G1)
Quality Score174.009
Status Validated
Chromosome17
Chromosomal Location35089263-35102987 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to C at 35098810 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007251] [ENSMUST00000173846]
Predicted Effect probably null
Transcript: ENSMUST00000007251
SMART Domains Protein: ENSMUSP00000007251
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 165 179 N/A INTRINSIC
Pfam:Abhydrolase_1 280 415 6.3e-10 PFAM
Pfam:Abhydrolase_5 282 465 4.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172584
SMART Domains Protein: ENSMUSP00000133610
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
SCOP:d1imja_ 33 101 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173247
SMART Domains Protein: ENSMUSP00000134231
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
Pfam:Abhydrolase_6 2 115 8.6e-6 PFAM
Pfam:Abhydrolase_5 3 123 3.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173579
Predicted Effect probably benign
Transcript: ENSMUST00000173846
SMART Domains Protein: ENSMUSP00000133505
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for tumor necrosis factor alpha and tumor necrosis factor beta. These genes are all within the human major histocompatibility complex class III region. The protein encoded by this gene is thought to be involved in some aspects of immunity. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, decreased body size and weight, and decreased brain lysophosphatidylserines. Macrophages display a reduction in lysophosphatidylserines and LPS-induced cytokine production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably null Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S859P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 H229Q probably benign Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 G134D probably benign Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 probably benign Het
Mfsd8 A G 3: 40,819,596 V493A possibly damaging Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 T2265I probably benign Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y117* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 probably benign Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T147A probably damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M195K probably benign Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Abhd16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Abhd16a APN 17 35091037 missense probably damaging 0.96
IGL01943:Abhd16a APN 17 35096483 unclassified probably benign 0.00
IGL01955:Abhd16a APN 17 35101340 missense probably damaging 1.00
IGL02563:Abhd16a APN 17 35101245 missense probably damaging 1.00
R0765:Abhd16a UTSW 17 35101851 missense probably benign 0.12
R1931:Abhd16a UTSW 17 35101015 missense probably benign 0.00
R3788:Abhd16a UTSW 17 35101587 missense probably damaging 0.99
R3789:Abhd16a UTSW 17 35101587 missense probably damaging 0.99
R4567:Abhd16a UTSW 17 35096523 missense probably damaging 1.00
R4587:Abhd16a UTSW 17 35101087 critical splice donor site probably null
R4701:Abhd16a UTSW 17 35096606 critical splice donor site probably null
R4736:Abhd16a UTSW 17 35101883 missense probably benign 0.01
R4959:Abhd16a UTSW 17 35102342 missense probably benign 0.26
R4973:Abhd16a UTSW 17 35102342 missense probably benign 0.26
R5338:Abhd16a UTSW 17 35094302 missense probably damaging 1.00
R5896:Abhd16a UTSW 17 35091725 intron probably benign
R6533:Abhd16a UTSW 17 35098809 critical splice donor site probably null
R6881:Abhd16a UTSW 17 35096601 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGGGCCAAGATGAATCCCTG -3'
(R):5'- GAGTCTCTACTGCCACCTACCA -3'

Sequencing Primer
(F):5'- AAGATGAATCCCTGGGCCCTG -3'
(R):5'- ACCAGCTTCTGCCCCTGG -3'
Posted OnAug 16, 2017