Incidental Mutation 'R6092:Uty'
ID486020
Institutional Source Beutler Lab
Gene Symbol Uty
Ensembl Gene ENSMUSG00000068457
Gene Nameubiquitously transcribed tetratricopeptide repeat gene, Y chromosome
SynonymsHydb
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6092 (G1)
Quality Score221.999
Status Validated
ChromosomeY
Chromosomal Location1096861-1245759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 1174836 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 248 (M248K)
Ref Sequence ENSEMBL: ENSMUSP00000119406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069309] [ENSMUST00000137048] [ENSMUST00000139365] [ENSMUST00000143286] [ENSMUST00000154004]
Predicted Effect probably benign
Transcript: ENSMUST00000069309
AA Change: M251K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000070012
Gene: ENSMUSG00000068457
AA Change: M251K

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
TPR 88 121 1.51e1 SMART
TPR 125 158 2.26e-3 SMART
TPR 200 233 2.31e0 SMART
TPR 279 312 6.19e-1 SMART
TPR 313 346 4.21e-3 SMART
TPR 347 380 8.97e0 SMART
Blast:JmjC 389 470 2e-28 BLAST
low complexity region 534 551 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 693 705 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 784 795 N/A INTRINSIC
JmjC 907 1070 5.22e-47 SMART
Blast:JmjC 1106 1170 1e-27 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000137048
AA Change: M248K

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119406
Gene: ENSMUSG00000068457
AA Change: M248K

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
TPR 85 118 1.51e1 SMART
TPR 122 155 2.26e-3 SMART
TPR 197 230 2.31e0 SMART
TPR 276 309 6.19e-1 SMART
TPR 310 343 4.21e-3 SMART
TPR 344 377 8.97e0 SMART
Blast:JmjC 452 647 6e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139365
AA Change: M250K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000114752
Gene: ENSMUSG00000068457
AA Change: M250K

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
TPR 87 120 1.51e1 SMART
TPR 124 157 2.26e-3 SMART
TPR 199 232 2.31e0 SMART
TPR 278 311 6.19e-1 SMART
TPR 312 345 4.21e-3 SMART
TPR 346 379 8.97e0 SMART
Blast:JmjC 388 469 2e-28 BLAST
low complexity region 533 550 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 730 743 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
JmjC 906 1069 5.22e-47 SMART
Blast:JmjC 1105 1169 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143286
AA Change: M195K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115113
Gene: ENSMUSG00000068457
AA Change: M195K

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
TPR 69 102 2.26e-3 SMART
TPR 144 177 2.31e0 SMART
TPR 223 256 6.19e-1 SMART
TPR 257 290 4.21e-3 SMART
TPR 291 324 8.97e0 SMART
low complexity region 433 450 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 683 694 N/A INTRINSIC
JmjC 806 969 5.22e-47 SMART
Blast:JmjC 1005 1069 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154004
AA Change: M188K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000114910
Gene: ENSMUSG00000068457
AA Change: M188K

DomainStartEndE-ValueType
TPR 25 58 1.51e1 SMART
TPR 62 95 2.26e-3 SMART
TPR 137 170 2.31e0 SMART
TPR 216 249 6.19e-1 SMART
TPR 250 283 4.21e-3 SMART
TPR 284 317 8.97e0 SMART
Blast:JmjC 326 407 2e-28 BLAST
low complexity region 471 488 N/A INTRINSIC
low complexity region 568 583 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 668 681 N/A INTRINSIC
low complexity region 721 732 N/A INTRINSIC
JmjC 844 1007 5.22e-47 SMART
Blast:JmjC 1043 1107 1e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157073
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype Mutant male mice hemizygous for a gene trapped allele are viable and fertile.
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abhd16a T C 17: 35,098,810 probably null Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably null Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S859P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 H229Q unknown Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 G134D unknown Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 unknown Het
Mfsd8 A G 3: 40,819,596 V493A possibly damaging Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 T2265I unknown Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y117* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 unknown Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T183A possibly damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Uty
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Uty UTSW Y 1197223 missense probably damaging 1.00
R0277:Uty UTSW Y 1169979 missense probably damaging 1.00
R0323:Uty UTSW Y 1169979 missense probably damaging 1.00
R1102:Uty UTSW Y 1174741 missense probably damaging 1.00
R1256:Uty UTSW Y 1134884 missense probably damaging 0.96
R1499:Uty UTSW Y 1197228 missense probably damaging 1.00
R1534:Uty UTSW Y 1245440 missense probably benign 0.41
R1643:Uty UTSW Y 1152054 missense probably damaging 1.00
R2070:Uty UTSW Y 1169193 missense probably benign 0.28
R2101:Uty UTSW Y 1176541 missense probably damaging 0.99
R2146:Uty UTSW Y 1239816 missense probably benign 0.25
R2508:Uty UTSW Y 1158182 missense probably damaging 0.99
R3036:Uty UTSW Y 1099671 nonsense probably null
R3437:Uty UTSW Y 1158336 missense probably benign 0.23
R3547:Uty UTSW Y 1158512 missense possibly damaging 0.84
R4153:Uty UTSW Y 1158327 missense possibly damaging 0.68
R4388:Uty UTSW Y 1151956 missense possibly damaging 0.94
R4467:Uty UTSW Y 1158372 missense possibly damaging 0.57
R4607:Uty UTSW Y 1131134 missense probably damaging 1.00
R4608:Uty UTSW Y 1131134 missense probably damaging 1.00
R4684:Uty UTSW Y 1176502 nonsense probably null
R4948:Uty UTSW Y 1136883 missense probably damaging 1.00
R5129:Uty UTSW Y 1158592 missense probably benign 0.13
R5387:Uty UTSW Y 1189339 missense probably damaging 1.00
R5408:Uty UTSW Y 1245614 missense possibly damaging 0.46
R5487:Uty UTSW Y 1174825 missense probably damaging 1.00
R5677:Uty UTSW Y 1134902 missense probably damaging 1.00
R5806:Uty UTSW Y 1170921 missense probably damaging 1.00
R6047:Uty UTSW Y 1158288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTTTCGGGATAGCATTTGAAATG -3'
(R):5'- AAACCATTGCCTGTTGGGTAC -3'

Sequencing Primer
(F):5'- CATTCTCACCTCTTAGTAGTTAT -3'
(R):5'- GCAGTAGGTTGTCTTACCAAGTAGC -3'
Posted OnAug 16, 2017