Incidental Mutation 'R6093:Gm11487'
ID486033
Institutional Source Beutler Lab
Gene Symbol Gm11487
Ensembl Gene ENSMUSG00000066137
Gene Namepredicted gene 11487
Synonyms
MMRRC Submission 044250-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R6093 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location73401032-73405072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73402021 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 174 (I174V)
Ref Sequence ENSEMBL: ENSMUSP00000081520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084480]
Predicted Effect probably benign
Transcript: ENSMUST00000084480
AA Change: I174V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000081520
Gene: ENSMUSG00000066137
AA Change: I174V

DomainStartEndE-ValueType
low complexity region 69 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147434
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to a family of related genes tandemly arranged in two clusters on chromosome 4. This family, which appears to be mouse-specific and composed of multiple highly similar members, is supported by limited transcript data. Members of the family maintain an intact open reading frame although the encoded protein has no known function. This gene is inferred from alignment of paralogous transcripts. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,659,870 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl3 A C 5: 81,646,522 R531S probably benign Het
Ahctf1 T C 1: 179,762,952 D1252G probably benign Het
Ano1 T C 7: 144,611,377 N648S possibly damaging Het
Antxr2 C A 5: 98,030,460 L30F probably damaging Het
Apol9a T A 15: 77,404,420 N249I probably benign Het
Atp2a1 A G 7: 126,446,921 V977A probably damaging Het
Clmn T C 12: 104,771,956 T968A probably benign Het
Clstn2 A T 9: 97,458,210 I703N probably damaging Het
Cnot1 T C 8: 95,748,894 T1051A probably benign Het
Csde1 A G 3: 103,052,902 Y615C probably damaging Het
Dcaf17 A G 2: 71,082,012 K314E possibly damaging Het
Dnah10 A T 5: 124,753,174 I711F probably benign Het
Duox1 G T 2: 122,347,274 R1513L probably benign Het
Exph5 A G 9: 53,372,617 T333A possibly damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Gcgr T A 11: 120,538,121 L395Q probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Greb1 C T 12: 16,684,486 C1501Y probably benign Het
Iqgap2 A G 13: 95,628,963 V1533A probably damaging Het
Kcnc3 A C 7: 44,591,508 D208A probably benign Het
Kctd14 A G 7: 97,454,953 probably benign Het
Mcm5 C A 8: 75,109,746 D13E probably benign Het
Med23 A G 10: 24,878,443 I221V probably benign Het
Myo19 T C 11: 84,885,709 F64L probably damaging Het
Ncapd3 T G 9: 27,056,158 S597A probably damaging Het
Neb A T 2: 52,251,770 Y72* probably null Het
Nrip1 C T 16: 76,294,764 probably benign Het
Olfr196 T A 16: 59,167,967 M59L probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Phkb T A 8: 85,942,329 D328E probably damaging Het
Phyh G T 2: 4,919,085 A6S possibly damaging Het
Pole A T 5: 110,312,090 Q1120L probably benign Het
Rbmxl1 T C 8: 78,505,943 Y257C probably damaging Het
Smurf2 A T 11: 106,868,623 H69Q possibly damaging Het
Tmem167b A T 3: 108,562,123 M1K probably null Het
Tmod4 A T 3: 95,125,618 T22S probably benign Het
Triml1 T C 8: 43,140,718 I149M probably benign Het
Vmn2r108 T C 17: 20,481,140 T33A probably benign Het
Vmn2r76 T A 7: 86,228,261 R525* probably null Het
Zfp109 A T 7: 24,229,133 W292R probably benign Het
Zfp292 C T 4: 34,811,902 A381T probably damaging Het
Zfp791 C T 8: 85,113,506 probably null Het
Other mutations in Gm11487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02373:Gm11487 APN 4 73403643 missense probably benign 0.01
IGL03275:Gm11487 APN 4 73403416 missense possibly damaging 0.80
R1066:Gm11487 UTSW 4 73401829 missense possibly damaging 0.46
R1274:Gm11487 UTSW 4 73403076 missense probably damaging 0.97
R1742:Gm11487 UTSW 4 73401210 missense probably damaging 1.00
R1863:Gm11487 UTSW 4 73401800 nonsense probably null
R1903:Gm11487 UTSW 4 73403438 missense probably damaging 0.98
R2027:Gm11487 UTSW 4 73403058 missense possibly damaging 0.46
R4011:Gm11487 UTSW 4 73401810 missense probably damaging 0.97
R4801:Gm11487 UTSW 4 73401267 nonsense probably null
R4802:Gm11487 UTSW 4 73401267 nonsense probably null
R5213:Gm11487 UTSW 4 73401334 missense probably damaging 0.96
R5334:Gm11487 UTSW 4 73403517 missense probably benign 0.31
R5345:Gm11487 UTSW 4 73401277 missense probably damaging 1.00
R6786:Gm11487 UTSW 4 73403606 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAGGGTACAGTCCTTGATCTCTCC -3'
(R):5'- ATGGTAGACTCTGGATCCTGGG -3'

Sequencing Primer
(F):5'- GATCTCTCCCTACTAAGAGTGGAG -3'
(R):5'- AGACTCTGGATCCTGGGCTCTC -3'
Posted On2017-08-16