Incidental Mutation 'R6093:Vmn2r76'
ID486041
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Namevomeronasal 2, receptor 76
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R6093 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86225206-86246201 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 86228261 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 525 (R525*)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
Predicted Effect probably null
Transcript: ENSMUST00000165771
AA Change: R525*
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: R525*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,659,870 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl3 A C 5: 81,646,522 R531S probably benign Het
Ahctf1 T C 1: 179,762,952 D1252G probably benign Het
Ano1 T C 7: 144,611,377 N648S possibly damaging Het
Antxr2 C A 5: 98,030,460 L30F probably damaging Het
Apol9a T A 15: 77,404,420 N249I probably benign Het
Atp2a1 A G 7: 126,446,921 V977A probably damaging Het
Clmn T C 12: 104,771,956 T968A probably benign Het
Clstn2 A T 9: 97,458,210 I703N probably damaging Het
Cnot1 T C 8: 95,748,894 T1051A probably benign Het
Csde1 A G 3: 103,052,902 Y615C probably damaging Het
Dcaf17 A G 2: 71,082,012 K314E possibly damaging Het
Dnah10 A T 5: 124,753,174 I711F probably benign Het
Duox1 G T 2: 122,347,274 R1513L probably benign Het
Exph5 A G 9: 53,372,617 T333A possibly damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Gcgr T A 11: 120,538,121 L395Q probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm11487 T C 4: 73,402,021 I174V probably benign Het
Greb1 C T 12: 16,684,486 C1501Y probably benign Het
Iqgap2 A G 13: 95,628,963 V1533A probably damaging Het
Kcnc3 A C 7: 44,591,508 D208A probably benign Het
Kctd14 A G 7: 97,454,953 probably benign Het
Mcm5 C A 8: 75,109,746 D13E probably benign Het
Med23 A G 10: 24,878,443 I221V probably benign Het
Myo19 T C 11: 84,885,709 F64L probably damaging Het
Ncapd3 T G 9: 27,056,158 S597A probably damaging Het
Neb A T 2: 52,251,770 Y72* probably null Het
Nrip1 C T 16: 76,294,764 probably benign Het
Olfr196 T A 16: 59,167,967 M59L probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Phkb T A 8: 85,942,329 D328E probably damaging Het
Phyh G T 2: 4,919,085 A6S possibly damaging Het
Pole A T 5: 110,312,090 Q1120L probably benign Het
Rbmxl1 T C 8: 78,505,943 Y257C probably damaging Het
Smurf2 A T 11: 106,868,623 H69Q possibly damaging Het
Tmem167b A T 3: 108,562,123 M1K probably null Het
Tmod4 A T 3: 95,125,618 T22S probably benign Het
Triml1 T C 8: 43,140,718 I149M probably benign Het
Vmn2r108 T C 17: 20,481,140 T33A probably benign Het
Zfp109 A T 7: 24,229,133 W292R probably benign Het
Zfp292 C T 4: 34,811,902 A381T probably damaging Het
Zfp791 C T 8: 85,113,506 probably null Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 86228717 missense probably benign
IGL01374:Vmn2r76 APN 7 86225649 missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 86225702 missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 86225663 missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 86230198 missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 86228717 missense probably benign
IGL02214:Vmn2r76 APN 7 86229930 missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 86228863 missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 86230148 missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 86228753 nonsense probably null
IGL02598:Vmn2r76 APN 7 86228671 missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 86225706 missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 86230287 missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 86229826 missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 86228779 missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 86230298 missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 86226115 critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 86230370 missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 86228696 missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 86230246 missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 86230148 missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 86231256 missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 86231011 missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 86230484 missense probably benign
R2181:Vmn2r76 UTSW 7 86225535 missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 86230499 missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 86225993 missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 86225555 missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 86226036 missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 86231207 missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 86230300 missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 86230532 missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 86228303 missense probably benign 0.16
R4796:Vmn2r76 UTSW 7 86230444 missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 86225525 missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 86228707 missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 86226059 missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 86225288 missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 86225449 missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 86226078 missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 86226053 missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 86245994 critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 86229934 missense probably benign 0.00
R6651:Vmn2r76 UTSW 7 86228851 missense possibly damaging 0.64
R6741:Vmn2r76 UTSW 7 86230352 missense probably benign
R6750:Vmn2r76 UTSW 7 86225906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGAAGTATGTGTTGTTTCAAGG -3'
(R):5'- CTACAGTGGGATGTTGCATTTTAAC -3'

Sequencing Primer
(F):5'- AAGTTCCCATAGGGAAGAT -3'
(R):5'- CAGTGGCATCATATTCCAAG -3'
Posted On2017-08-16