Incidental Mutation 'R6093:Exph5'
ID 486052
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Name exophilin 5
Synonyms AC079869.22gm5, Slac2b, slac2-b, B130009M24Rik
MMRRC Submission 044250-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6093 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 53212970-53288814 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53283917 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 333 (T333A)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
AlphaFold Q0VAV2
Predicted Effect possibly damaging
Transcript: ENSMUST00000051014
AA Change: T333A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: T333A

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132410
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,490,214 (GRCm39) probably benign Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Adgrl3 A C 5: 81,794,369 (GRCm39) R531S probably benign Het
Ahctf1 T C 1: 179,590,517 (GRCm39) D1252G probably benign Het
Ano1 T C 7: 144,165,114 (GRCm39) N648S possibly damaging Het
Antxr2 C A 5: 98,178,319 (GRCm39) L30F probably damaging Het
Apol9a T A 15: 77,288,620 (GRCm39) N249I probably benign Het
Atp2a1 A G 7: 126,046,093 (GRCm39) V977A probably damaging Het
Clmn T C 12: 104,738,215 (GRCm39) T968A probably benign Het
Clstn2 A T 9: 97,340,263 (GRCm39) I703N probably damaging Het
Cnot1 T C 8: 96,475,522 (GRCm39) T1051A probably benign Het
Csde1 A G 3: 102,960,218 (GRCm39) Y615C probably damaging Het
Dcaf17 A G 2: 70,912,356 (GRCm39) K314E possibly damaging Het
Dnah10 A T 5: 124,830,238 (GRCm39) I711F probably benign Het
Duox1 G T 2: 122,177,755 (GRCm39) R1513L probably benign Het
Fmnl2 A G 2: 53,004,880 (GRCm39) D658G probably damaging Het
Gcgr T A 11: 120,428,947 (GRCm39) L395Q probably damaging Het
Gm10801 C CGTA 2: 98,494,152 (GRCm39) probably null Het
Greb1 C T 12: 16,734,487 (GRCm39) C1501Y probably benign Het
Iqgap2 A G 13: 95,765,471 (GRCm39) V1533A probably damaging Het
Kcnc3 A C 7: 44,240,932 (GRCm39) D208A probably benign Het
Kctd14 A G 7: 97,104,160 (GRCm39) probably benign Het
Mcm5 C A 8: 75,836,374 (GRCm39) D13E probably benign Het
Med23 A G 10: 24,754,341 (GRCm39) I221V probably benign Het
Msantd5f6 T C 4: 73,320,258 (GRCm39) I174V probably benign Het
Myo19 T C 11: 84,776,535 (GRCm39) F64L probably damaging Het
Ncapd3 T G 9: 26,967,454 (GRCm39) S597A probably damaging Het
Neb A T 2: 52,141,782 (GRCm39) Y72* probably null Het
Nrip1 C T 16: 76,091,652 (GRCm39) probably benign Het
Or5h26 T A 16: 58,988,330 (GRCm39) M59L probably damaging Het
Otx1 A T 11: 21,949,406 (GRCm39) L24H probably damaging Het
Phkb T A 8: 86,668,958 (GRCm39) D328E probably damaging Het
Phyh G T 2: 4,923,896 (GRCm39) A6S possibly damaging Het
Pole A T 5: 110,459,956 (GRCm39) Q1120L probably benign Het
Rbmxl1 T C 8: 79,232,572 (GRCm39) Y257C probably damaging Het
Smurf2 A T 11: 106,759,449 (GRCm39) H69Q possibly damaging Het
Tmem167b A T 3: 108,469,439 (GRCm39) M1K probably null Het
Tmod4 A T 3: 95,032,929 (GRCm39) T22S probably benign Het
Triml1 T C 8: 43,593,755 (GRCm39) I149M probably benign Het
Vmn2r108 T C 17: 20,701,402 (GRCm39) T33A probably benign Het
Vmn2r76 T A 7: 85,877,469 (GRCm39) R525* probably null Het
Zfp109 A T 7: 23,928,558 (GRCm39) W292R probably benign Het
Zfp292 C T 4: 34,811,902 (GRCm39) A381T probably damaging Het
Zfp791 C T 8: 85,840,135 (GRCm39) probably null Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53,288,006 (GRCm39) nonsense probably null
IGL01387:Exph5 APN 9 53,285,265 (GRCm39) missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53,287,869 (GRCm39) missense probably damaging 0.99
IGL02122:Exph5 APN 9 53,284,974 (GRCm39) missense probably benign 0.05
IGL02156:Exph5 APN 9 53,286,941 (GRCm39) missense probably damaging 0.96
IGL02192:Exph5 APN 9 53,287,625 (GRCm39) nonsense probably null
IGL02491:Exph5 APN 9 53,286,343 (GRCm39) missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53,286,278 (GRCm39) missense probably damaging 0.96
R0002:Exph5 UTSW 9 53,285,256 (GRCm39) missense probably damaging 0.99
R0026:Exph5 UTSW 9 53,287,779 (GRCm39) missense probably benign 0.38
R0086:Exph5 UTSW 9 53,249,230 (GRCm39) missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53,264,504 (GRCm39) critical splice donor site probably null
R0369:Exph5 UTSW 9 53,284,602 (GRCm39) missense probably benign 0.35
R0409:Exph5 UTSW 9 53,285,643 (GRCm39) missense probably benign 0.00
R0517:Exph5 UTSW 9 53,284,062 (GRCm39) missense probably benign 0.02
R0658:Exph5 UTSW 9 53,288,775 (GRCm39) missense unknown
R1606:Exph5 UTSW 9 53,285,595 (GRCm39) missense probably benign 0.37
R1739:Exph5 UTSW 9 53,286,888 (GRCm39) missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53,285,109 (GRCm39) missense probably benign 0.35
R1828:Exph5 UTSW 9 53,287,941 (GRCm39) missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53,287,548 (GRCm39) missense probably benign
R1993:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53,278,466 (GRCm39) missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53,283,979 (GRCm39) missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53,286,225 (GRCm39) nonsense probably null
R3817:Exph5 UTSW 9 53,286,794 (GRCm39) nonsense probably null
R4771:Exph5 UTSW 9 53,284,965 (GRCm39) missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53,287,539 (GRCm39) missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53,287,925 (GRCm39) missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53,286,910 (GRCm39) missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53,249,230 (GRCm39) missense probably damaging 0.99
R5522:Exph5 UTSW 9 53,285,613 (GRCm39) missense possibly damaging 0.90
R5947:Exph5 UTSW 9 53,286,522 (GRCm39) missense probably benign 0.04
R5961:Exph5 UTSW 9 53,288,555 (GRCm39) missense probably damaging 1.00
R6144:Exph5 UTSW 9 53,284,328 (GRCm39) missense probably benign 0.21
R6254:Exph5 UTSW 9 53,284,010 (GRCm39) missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53,287,991 (GRCm39) missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53,213,012 (GRCm39) start gained probably benign
R6792:Exph5 UTSW 9 53,286,617 (GRCm39) missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53,251,728 (GRCm39) missense probably benign 0.27
R7340:Exph5 UTSW 9 53,288,309 (GRCm39) missense probably damaging 0.99
R7347:Exph5 UTSW 9 53,287,196 (GRCm39) missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53,287,022 (GRCm39) missense probably benign 0.00
R7520:Exph5 UTSW 9 53,278,514 (GRCm39) critical splice donor site probably null
R7521:Exph5 UTSW 9 53,285,377 (GRCm39) missense possibly damaging 0.89
R7560:Exph5 UTSW 9 53,287,073 (GRCm39) missense probably benign 0.41
R7581:Exph5 UTSW 9 53,283,857 (GRCm39) missense possibly damaging 0.90
R7726:Exph5 UTSW 9 53,284,475 (GRCm39) missense possibly damaging 0.62
R7976:Exph5 UTSW 9 53,287,935 (GRCm39) missense possibly damaging 0.79
R8017:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8019:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8302:Exph5 UTSW 9 53,287,776 (GRCm39) missense possibly damaging 0.89
R8420:Exph5 UTSW 9 53,287,148 (GRCm39) nonsense probably null
R8551:Exph5 UTSW 9 53,285,351 (GRCm39) missense possibly damaging 0.94
R8708:Exph5 UTSW 9 53,287,096 (GRCm39) missense probably benign
R8889:Exph5 UTSW 9 53,287,955 (GRCm39) missense probably damaging 1.00
R9048:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R9255:Exph5 UTSW 9 53,284,609 (GRCm39) missense possibly damaging 0.79
R9727:Exph5 UTSW 9 53,287,702 (GRCm39) missense probably damaging 0.96
X0028:Exph5 UTSW 9 53,287,563 (GRCm39) missense probably damaging 1.00
Z1177:Exph5 UTSW 9 53,288,719 (GRCm39) missense probably benign
Z1177:Exph5 UTSW 9 53,285,513 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TAACATCCTGAGACCTGGAACC -3'
(R):5'- GAGACACATATTGCTCCTCGGG -3'

Sequencing Primer
(F):5'- TGAGACCTGGAACCCCTAGAG -3'
(R):5'- ACATATTGCTCCTCGGGGTCAATG -3'
Posted On 2017-08-16