Incidental Mutation 'R6088:Baz2a'
List |< first << previous [record 55 of 585] next >> last >|
ID486101
Institutional Source Beutler Lab
Gene Symbol Baz2a
Ensembl Gene ENSMUSG00000040054
Gene Namebromodomain adjacent to zinc finger domain, 2A
SynonymsC030005G16Rik, Tip5, Walp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R6088 (G1)
Quality Score217.468
Status Validated
Chromosome10
Chromosomal Location128091577-128129303 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TCTCCTC to TCTC at 128114642 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045621] [ENSMUST00000170054] [ENSMUST00000217851] [ENSMUST00000219072] [ENSMUST00000220049]
Predicted Effect probably benign
Transcript: ENSMUST00000045621
SMART Domains Protein: ENSMUSP00000044359
Gene: ENSMUSG00000040054

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 421 475 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
MBD 539 614 3.87e-35 SMART
AT_hook 639 651 2.38e0 SMART
AT_hook 660 672 1.65e0 SMART
low complexity region 697 710 N/A INTRINSIC
coiled coil region 736 776 N/A INTRINSIC
DDT 837 902 3.75e-18 SMART
Pfam:WHIM1 939 988 4.8e-8 PFAM
low complexity region 1001 1013 N/A INTRINSIC
AT_hook 1174 1186 6.23e1 SMART
AT_hook 1388 1400 4.21e0 SMART
Pfam:WHIM3 1423 1464 1e-9 PFAM
PHD 1662 1708 1.47e-11 SMART
low complexity region 1741 1753 N/A INTRINSIC
BROMO 1773 1881 7.71e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170054
SMART Domains Protein: ENSMUSP00000129803
Gene: ENSMUSG00000040054

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
low complexity region 422 476 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
MBD 540 615 3.87e-35 SMART
AT_hook 640 652 2.38e0 SMART
AT_hook 661 673 1.65e0 SMART
low complexity region 698 711 N/A INTRINSIC
coiled coil region 737 777 N/A INTRINSIC
DDT 838 903 3.75e-18 SMART
Pfam:WHIM1 940 989 4.8e-8 PFAM
low complexity region 1002 1014 N/A INTRINSIC
AT_hook 1175 1187 6.23e1 SMART
AT_hook 1389 1401 4.21e0 SMART
Pfam:WHIM3 1424 1462 5.5e-19 PFAM
PHD 1663 1709 1.47e-11 SMART
low complexity region 1742 1754 N/A INTRINSIC
BROMO 1774 1882 7.71e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218772
Predicted Effect probably benign
Transcript: ENSMUST00000219072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219980
Predicted Effect probably benign
Transcript: ENSMUST00000220049
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,902,102 V360F probably damaging Het
Ankrd17 C T 5: 90,253,688 E1605K possibly damaging Het
Arid4a A G 12: 71,022,236 D54G probably damaging Het
Card6 A T 15: 5,105,019 V234E possibly damaging Het
Cd1d1 G T 3: 86,998,702 Q89K probably benign Het
Ciita G A 16: 10,511,931 R693K probably damaging Het
Cox7a2l G T 17: 83,503,972 L77I probably benign Het
Crybg2 A T 4: 134,075,790 probably null Het
Cts8 T C 13: 61,253,966 N39S probably benign Het
Def8 G T 8: 123,460,048 E456* probably null Het
Dld A G 12: 31,340,989 F153L probably benign Het
Elf1 C T 14: 79,567,261 T122I probably benign Het
Emilin2 T C 17: 71,255,124 N961S probably benign Het
Esp24 A G 17: 39,040,010 I34V probably benign Het
Fam129b T C 2: 32,923,123 V540A probably damaging Het
Fam184b C A 5: 45,584,012 K292N probably damaging Het
Gabrg3 T A 7: 56,985,078 N119I probably damaging Het
Gucy1b1 T C 3: 82,034,880 H524R probably damaging Het
Kcp A T 6: 29,502,632 S205T probably benign Het
Klb C T 5: 65,349,013 T201M probably benign Het
Lamp3 A T 16: 19,673,398 F365L probably damaging Het
Mad1l1 T A 5: 140,193,963 H390L probably benign Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Myo5b T A 18: 74,720,898 L1196Q possibly damaging Het
Ndufb8 A G 19: 44,555,025 S70P probably benign Het
Neb T C 2: 52,209,342 D4832G probably damaging Het
Nr5a1 T C 2: 38,701,995 D322G probably benign Het
Olfr396-ps1 A T 11: 73,928,823 T273S probably benign Het
Olfr988 T A 2: 85,353,354 S191C probably damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Oxa1l T A 14: 54,367,694 probably null Het
Pafah2 A G 4: 134,413,381 I221V probably benign Het
Pibf1 T A 14: 99,179,358 F456I probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekhg2 C T 7: 28,361,013 V964I probably benign Het
Ppip5k1 C A 2: 121,337,463 V770L probably benign Het
Ppl A T 16: 5,104,988 L213Q possibly damaging Het
Ptprf G A 4: 118,210,755 T1785I possibly damaging Het
Pycr2 G A 1: 180,906,236 G131E probably damaging Het
Rbpj C T 5: 53,651,368 probably null Het
Rcc1 G T 4: 132,332,842 D430E probably benign Het
Rhbdf1 A G 11: 32,212,007 V525A possibly damaging Het
Samd7 G A 3: 30,756,483 M216I probably benign Het
Ska3 A T 14: 57,816,694 D266E probably benign Het
Slc1a7 G A 4: 108,012,444 V569M probably damaging Het
Slc26a1 C T 5: 108,674,006 E6K possibly damaging Het
Slc4a4 T A 5: 89,197,704 V741E probably benign Het
St6galnac3 C T 3: 153,206,715 G164S probably damaging Het
Tgs1 T A 4: 3,595,383 N517K probably benign Het
Tns4 A G 11: 99,073,720 S522P probably damaging Het
Trpm1 A T 7: 64,267,976 M355L probably damaging Het
Trpm8 G A 1: 88,306,678 probably benign Het
Uhrf1bp1 G A 17: 27,884,605 probably null Het
V1ra8 T C 6: 90,203,100 F95S probably damaging Het
Zfp521 A C 18: 13,846,109 S416A possibly damaging Het
Zfp574 T A 7: 25,080,339 V262E probably benign Het
Zfp740 T A 15: 102,208,808 I77N probably damaging Het
Zscan18 A T 7: 12,775,198 probably benign Het
Other mutations in Baz2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Baz2a APN 10 128124935 missense probably benign 0.00
IGL00501:Baz2a APN 10 128114625 missense probably benign 0.14
IGL00743:Baz2a APN 10 128114526 missense probably benign
IGL01362:Baz2a APN 10 128121964 missense probably damaging 0.98
IGL01394:Baz2a APN 10 128118645 missense possibly damaging 0.46
IGL01603:Baz2a APN 10 128111168 missense probably damaging 0.98
IGL02165:Baz2a APN 10 128119349 missense probably benign 0.03
IGL02732:Baz2a APN 10 128125175 missense possibly damaging 0.66
IGL03030:Baz2a APN 10 128125146 missense possibly damaging 0.62
IGL03087:Baz2a APN 10 128122313 missense probably damaging 0.99
R0255:Baz2a UTSW 10 128114639 missense possibly damaging 0.66
R0737:Baz2a UTSW 10 128116080 missense possibly damaging 0.92
R0742:Baz2a UTSW 10 128113666 nonsense probably null
R0755:Baz2a UTSW 10 128119691 missense possibly damaging 0.92
R0798:Baz2a UTSW 10 128126323 splice site probably benign
R0879:Baz2a UTSW 10 128121304 missense probably damaging 0.99
R1023:Baz2a UTSW 10 128121807 missense possibly damaging 0.66
R1482:Baz2a UTSW 10 128109008 missense possibly damaging 0.92
R1512:Baz2a UTSW 10 128124152 missense possibly damaging 0.95
R1658:Baz2a UTSW 10 128124383 missense probably benign 0.04
R1983:Baz2a UTSW 10 128123959 missense probably benign 0.14
R2059:Baz2a UTSW 10 128113578 missense probably damaging 0.98
R2141:Baz2a UTSW 10 128123612 missense probably damaging 1.00
R2921:Baz2a UTSW 10 128125077 frame shift probably null
R2922:Baz2a UTSW 10 128125077 frame shift probably null
R3104:Baz2a UTSW 10 128125077 frame shift probably null
R3105:Baz2a UTSW 10 128125077 frame shift probably null
R3106:Baz2a UTSW 10 128125077 frame shift probably null
R3621:Baz2a UTSW 10 128125077 frame shift probably null
R3872:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3873:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3875:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R4600:Baz2a UTSW 10 128121183 missense probably damaging 0.97
R4692:Baz2a UTSW 10 128124893 missense probably damaging 1.00
R4717:Baz2a UTSW 10 128124942 missense possibly damaging 0.83
R4821:Baz2a UTSW 10 128111109 missense probably damaging 1.00
R4832:Baz2a UTSW 10 128123130 missense probably benign 0.08
R4893:Baz2a UTSW 10 128123415 missense possibly damaging 0.66
R4907:Baz2a UTSW 10 128110808 missense probably damaging 0.99
R5133:Baz2a UTSW 10 128116126 missense probably damaging 1.00
R5340:Baz2a UTSW 10 128115042 missense probably damaging 1.00
R5527:Baz2a UTSW 10 128124917 missense probably damaging 1.00
R5761:Baz2a UTSW 10 128119690 missense possibly damaging 0.66
R5891:Baz2a UTSW 10 128121322 missense probably damaging 1.00
R6089:Baz2a UTSW 10 128114642 small deletion probably benign
R6323:Baz2a UTSW 10 128126417 missense probably benign 0.21
R6894:Baz2a UTSW 10 128123581 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GTACTCAACTACATCCAGCAGTTTC -3'
(R):5'- CCATATGTGACATGTGCTTCTG -3'

Sequencing Primer
(F):5'- TCCAGCAGTTTCACCAACAG -3'
(R):5'- TGACATGTGCTTCTGTAGAGAAC -3'
Posted On2017-08-16