Incidental Mutation 'R6030:Sdccag3'
ID486171
Institutional Source Beutler Lab
Gene Symbol Sdccag3
Ensembl Gene ENSMUSG00000026927
Gene Nameserologically defined colon cancer antigen 3
Synonyms
MMRRC Submission 044202-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6030 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location26382802-26389316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26386971 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 249 (D249G)
Ref Sequence ENSEMBL: ENSMUSP00000109737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028293] [ENSMUST00000076431] [ENSMUST00000077983] [ENSMUST00000114093] [ENSMUST00000114100] [ENSMUST00000114102] [ENSMUST00000139738]
Predicted Effect probably benign
Transcript: ENSMUST00000028293
AA Change: D199G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028293
Gene: ENSMUSG00000026927
AA Change: D199G

DomainStartEndE-ValueType
coiled coil region 209 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076431
SMART Domains Protein: ENSMUSP00000075762
Gene: ENSMUSG00000026926

DomainStartEndE-ValueType
Pfam:Peptidase_M16 76 226 4.5e-47 PFAM
Pfam:Peptidase_M16_C 231 430 4.1e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000077983
AA Change: D176G

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077133
Gene: ENSMUSG00000026927
AA Change: D176G

DomainStartEndE-ValueType
coiled coil region 186 298 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114093
SMART Domains Protein: ENSMUSP00000109727
Gene: ENSMUSG00000026926

DomainStartEndE-ValueType
Pfam:Peptidase_M16 76 226 1.6e-47 PFAM
Pfam:Peptidase_M16_C 231 420 9.6e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114100
AA Change: D226G

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109735
Gene: ENSMUSG00000026927
AA Change: D226G

DomainStartEndE-ValueType
coiled coil region 236 348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114102
AA Change: D249G

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109737
Gene: ENSMUSG00000026927
AA Change: D249G

DomainStartEndE-ValueType
coiled coil region 259 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139535
Predicted Effect probably benign
Transcript: ENSMUST00000139738
SMART Domains Protein: ENSMUSP00000121256
Gene: ENSMUSG00000026927

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152375
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,255,733 W59R probably damaging Het
Abca16 A G 7: 120,533,798 N1317D probably benign Het
Abhd8 T A 8: 71,458,150 Y338F possibly damaging Het
Actg2 G T 6: 83,516,364 N297K probably damaging Het
Agap1 A G 1: 89,630,434 D148G probably damaging Het
Alox12 T C 11: 70,254,591 D52G possibly damaging Het
Ano5 T A 7: 51,574,825 S496T probably damaging Het
Arl6ip4 T C 5: 124,117,905 probably null Het
Atp4a G C 7: 30,722,516 E826Q probably damaging Het
Bbs7 T C 3: 36,602,911 D256G probably damaging Het
Bckdha T A 7: 25,631,441 D50V probably damaging Het
Cast A G 13: 74,695,937 S693P possibly damaging Het
Col6a1 T C 10: 76,709,866 Y924C unknown Het
Crkl A G 16: 17,452,740 Y88C probably damaging Het
Cse1l T C 2: 166,919,621 F32L probably benign Het
Dmxl2 C T 9: 54,393,673 V2385I probably benign Het
Dnah1 T A 14: 31,268,027 I3219F probably damaging Het
Dnah17 C T 11: 118,025,549 R4266H probably benign Het
Efcab5 A G 11: 77,121,262 L722P probably damaging Het
Emilin3 C A 2: 160,909,185 V215L probably benign Het
Esr1 A T 10: 4,746,622 N157I possibly damaging Het
Esrrg A G 1: 188,198,707 M309V probably benign Het
Fam120b G A 17: 15,401,910 R50Q probably damaging Het
Fat2 G T 11: 55,310,303 Y648* probably null Het
Gbp2b T A 3: 142,603,653 I175N probably benign Het
Gm1043 T A 5: 37,154,608 probably benign Het
Gm21060 A G 19: 61,296,973 C33R possibly damaging Het
Gm9803 C T 10: 43,524,256 A30V probably benign Het
Gpx6 C T 13: 21,312,340 S28L probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifi44 T C 3: 151,749,558 Q10R probably benign Het
Impa2 T C 18: 67,318,428 V264A probably benign Het
Khdc1a A T 1: 21,350,884 M98L probably benign Het
Lrrc45 T A 11: 120,720,648 L616* probably null Het
Mios A T 6: 8,215,704 H300L probably benign Het
Mllt6 A T 11: 97,677,225 T827S probably damaging Het
Mrc1 C A 2: 14,316,901 D1068E probably benign Het
Ndst3 T C 3: 123,552,519 Y702C probably damaging Het
Nek11 T A 9: 105,204,888 probably null Het
Nek4 T C 14: 30,956,933 F138S probably damaging Het
Nfatc4 T A 14: 55,832,440 Y688* probably null Het
Nlrx1 C T 9: 44,263,760 V240M probably damaging Het
Npy6r A T 18: 44,276,082 Y190F probably benign Het
Olfr338 T G 2: 36,377,544 L256R probably damaging Het
Olfr472 A G 7: 107,903,413 E232G probably benign Het
Olfr509 A C 7: 108,646,226 S117A possibly damaging Het
Olfr548-ps1 C A 7: 102,542,610 R225S probably benign Het
Olfr780 A T 10: 129,322,369 T249S probably benign Het
Olfr960 T C 9: 39,623,341 F71L probably damaging Het
Osbpl7 A C 11: 97,052,261 H113P probably benign Het
Pck1 A G 2: 173,154,857 E188G probably benign Het
Pimreg A G 11: 72,045,750 D213G probably benign Het
Pkd1l2 A G 8: 117,043,237 I1160T probably damaging Het
Ppargc1b G A 18: 61,307,934 Q622* probably null Het
Ppfia2 T A 10: 106,906,477 C1044S probably damaging Het
Ppp4r3a A G 12: 101,058,400 V280A probably damaging Het
Ptprf T C 4: 118,211,048 N1764D probably benign Het
Pygm C T 19: 6,388,812 R311C possibly damaging Het
Rab7b A G 1: 131,698,561 K109R probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Setbp1 T G 18: 78,857,711 I914L probably benign Het
Shprh A C 10: 11,151,991 Q114P probably benign Het
Slc5a9 T C 4: 111,885,528 I456V possibly damaging Het
Slc8b1 T C 5: 120,519,920 probably null Het
Spin1 T A 13: 51,139,516 Y87* probably null Het
Srebf2 T C 15: 82,177,276 probably null Het
Sufu T C 19: 46,475,539 Y397H probably damaging Het
Tgfb3 A C 12: 86,063,850 V242G probably benign Het
Tgm3 A T 2: 130,042,000 Y526F probably damaging Het
Tmem209 A G 6: 30,482,968 L508P probably damaging Het
Tmem67 T C 4: 12,063,799 D454G probably benign Het
Ttn T C 2: 76,816,599 E3280G possibly damaging Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Umps A G 16: 33,962,138 V138A probably benign Het
Wdr66 C T 5: 123,274,204 T532M probably damaging Het
Ypel1 A G 16: 17,084,513 probably null Het
Zdhhc19 T A 16: 32,499,042 L63Q probably null Het
Other mutations in Sdccag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02480:Sdccag3 APN 2 26385120 missense probably damaging 0.98
IGL03293:Sdccag3 APN 2 26387676 splice site probably benign
R0385:Sdccag3 UTSW 2 26387659 missense possibly damaging 0.82
R1707:Sdccag3 UTSW 2 26387606 missense probably damaging 1.00
R2035:Sdccag3 UTSW 2 26383627 missense probably damaging 1.00
R3743:Sdccag3 UTSW 2 26388643 intron probably benign
R3977:Sdccag3 UTSW 2 26384793 missense probably damaging 1.00
R4592:Sdccag3 UTSW 2 26388897 unclassified probably benign
R5389:Sdccag3 UTSW 2 26385547 missense probably damaging 1.00
R6030:Sdccag3 UTSW 2 26386971 missense possibly damaging 0.71
R6381:Sdccag3 UTSW 2 26385081 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGGGCAATTCTACATCAAGC -3'
(R):5'- AACCTACTTGCCATCTGCCG -3'

Sequencing Primer
(F):5'- ATATGACTAACTGCCTTGTCCGTGG -3'
(R):5'- GTGGATCAGACTCATTCCTCTAGAG -3'
Posted On2017-08-16