Incidental Mutation 'R6030:Ano5'
ID486195
Institutional Source Beutler Lab
Gene Symbol Ano5
Ensembl Gene ENSMUSG00000055489
Gene Nameanoctamin 5
SynonymsGdd1, Tmem16e
MMRRC Submission 044202-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6030 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location51511029-51598709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51574825 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 496 (S496T)
Ref Sequence ENSEMBL: ENSMUSP00000146783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043944] [ENSMUST00000207044] [ENSMUST00000207717]
Predicted Effect probably damaging
Transcript: ENSMUST00000043944
AA Change: S510T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046884
Gene: ENSMUSG00000055489
AA Change: S510T

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
Pfam:Anoct_dimer 64 280 7.7e-70 PFAM
Pfam:Anoctamin 283 860 6.5e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207044
AA Change: S477T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000207717
AA Change: S496T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to have little anion conductance activity. Elevated levels of this protein were found in dystrophic mice. In humans, mutations of this gene are associated with with musculoskeletal disorders such as myopathies, muscular dystrophy and gnathodiaphyseal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: One type of homozygous KO causes abnormalities in skeletal muscle mitochondria and impairs muscle regeneration and repair, leading to exercise intolerance. Another type of homozygous KO impairs sperm motility, leading to male subfertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,255,733 W59R probably damaging Het
Abca16 A G 7: 120,533,798 N1317D probably benign Het
Abhd8 T A 8: 71,458,150 Y338F possibly damaging Het
Actg2 G T 6: 83,516,364 N297K probably damaging Het
Agap1 A G 1: 89,630,434 D148G probably damaging Het
Alox12 T C 11: 70,254,591 D52G possibly damaging Het
Arl6ip4 T C 5: 124,117,905 probably null Het
Atp4a G C 7: 30,722,516 E826Q probably damaging Het
Bbs7 T C 3: 36,602,911 D256G probably damaging Het
Bckdha T A 7: 25,631,441 D50V probably damaging Het
Cast A G 13: 74,695,937 S693P possibly damaging Het
Col6a1 T C 10: 76,709,866 Y924C unknown Het
Crkl A G 16: 17,452,740 Y88C probably damaging Het
Cse1l T C 2: 166,919,621 F32L probably benign Het
Dmxl2 C T 9: 54,393,673 V2385I probably benign Het
Dnah1 T A 14: 31,268,027 I3219F probably damaging Het
Dnah17 C T 11: 118,025,549 R4266H probably benign Het
Efcab5 A G 11: 77,121,262 L722P probably damaging Het
Emilin3 C A 2: 160,909,185 V215L probably benign Het
Esr1 A T 10: 4,746,622 N157I possibly damaging Het
Esrrg A G 1: 188,198,707 M309V probably benign Het
Fam120b G A 17: 15,401,910 R50Q probably damaging Het
Fat2 G T 11: 55,310,303 Y648* probably null Het
Gbp2b T A 3: 142,603,653 I175N probably benign Het
Gm1043 T A 5: 37,154,608 probably benign Het
Gm21060 A G 19: 61,296,973 C33R possibly damaging Het
Gm9803 C T 10: 43,524,256 A30V probably benign Het
Gpx6 C T 13: 21,312,340 S28L probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifi44 T C 3: 151,749,558 Q10R probably benign Het
Impa2 T C 18: 67,318,428 V264A probably benign Het
Khdc1a A T 1: 21,350,884 M98L probably benign Het
Lrrc45 T A 11: 120,720,648 L616* probably null Het
Mios A T 6: 8,215,704 H300L probably benign Het
Mllt6 A T 11: 97,677,225 T827S probably damaging Het
Mrc1 C A 2: 14,316,901 D1068E probably benign Het
Ndst3 T C 3: 123,552,519 Y702C probably damaging Het
Nek11 T A 9: 105,204,888 probably null Het
Nek4 T C 14: 30,956,933 F138S probably damaging Het
Nfatc4 T A 14: 55,832,440 Y688* probably null Het
Nlrx1 C T 9: 44,263,760 V240M probably damaging Het
Npy6r A T 18: 44,276,082 Y190F probably benign Het
Olfr338 T G 2: 36,377,544 L256R probably damaging Het
Olfr472 A G 7: 107,903,413 E232G probably benign Het
Olfr509 A C 7: 108,646,226 S117A possibly damaging Het
Olfr548-ps1 C A 7: 102,542,610 R225S probably benign Het
Olfr780 A T 10: 129,322,369 T249S probably benign Het
Olfr960 T C 9: 39,623,341 F71L probably damaging Het
Osbpl7 A C 11: 97,052,261 H113P probably benign Het
Pck1 A G 2: 173,154,857 E188G probably benign Het
Pimreg A G 11: 72,045,750 D213G probably benign Het
Pkd1l2 A G 8: 117,043,237 I1160T probably damaging Het
Ppargc1b G A 18: 61,307,934 Q622* probably null Het
Ppfia2 T A 10: 106,906,477 C1044S probably damaging Het
Ppp4r3a A G 12: 101,058,400 V280A probably damaging Het
Ptprf T C 4: 118,211,048 N1764D probably benign Het
Pygm C T 19: 6,388,812 R311C possibly damaging Het
Rab7b A G 1: 131,698,561 K109R probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Sdccag3 T C 2: 26,386,971 D249G possibly damaging Het
Setbp1 T G 18: 78,857,711 I914L probably benign Het
Shprh A C 10: 11,151,991 Q114P probably benign Het
Slc5a9 T C 4: 111,885,528 I456V possibly damaging Het
Slc8b1 T C 5: 120,519,920 probably null Het
Spin1 T A 13: 51,139,516 Y87* probably null Het
Srebf2 T C 15: 82,177,276 probably null Het
Sufu T C 19: 46,475,539 Y397H probably damaging Het
Tgfb3 A C 12: 86,063,850 V242G probably benign Het
Tgm3 A T 2: 130,042,000 Y526F probably damaging Het
Tmem209 A G 6: 30,482,968 L508P probably damaging Het
Tmem67 T C 4: 12,063,799 D454G probably benign Het
Ttn T C 2: 76,816,599 E3280G possibly damaging Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Umps A G 16: 33,962,138 V138A probably benign Het
Wdr66 C T 5: 123,274,204 T532M probably damaging Het
Ypel1 A G 16: 17,084,513 probably null Het
Zdhhc19 T A 16: 32,499,042 L63Q probably null Het
Other mutations in Ano5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Ano5 APN 7 51566513 missense probably damaging 0.96
IGL01328:Ano5 APN 7 51556271 critical splice donor site probably null
IGL01800:Ano5 APN 7 51573075 critical splice donor site probably null
IGL01888:Ano5 APN 7 51566300 missense probably benign 0.06
IGL02221:Ano5 APN 7 51570323 missense probably damaging 1.00
IGL02538:Ano5 APN 7 51583775 missense probably damaging 1.00
IGL03027:Ano5 APN 7 51566277 missense probably damaging 0.99
IGL03133:Ano5 APN 7 51576512 nonsense probably null
IGL03167:Ano5 APN 7 51585511 missense probably damaging 0.98
IGL03233:Ano5 APN 7 51570368 missense probably damaging 1.00
PIT4466001:Ano5 UTSW 7 51544851 missense probably damaging 1.00
R0233:Ano5 UTSW 7 51535470 missense possibly damaging 0.94
R0233:Ano5 UTSW 7 51535470 missense possibly damaging 0.94
R0675:Ano5 UTSW 7 51574810 missense probably damaging 1.00
R0723:Ano5 UTSW 7 51587758 missense probably benign 0.20
R0764:Ano5 UTSW 7 51537842 splice site probably benign
R1159:Ano5 UTSW 7 51579474 splice site probably benign
R1218:Ano5 UTSW 7 51570421 splice site probably null
R1288:Ano5 UTSW 7 51546872 missense probably damaging 1.00
R1329:Ano5 UTSW 7 51546785 missense probably benign
R1484:Ano5 UTSW 7 51566320 missense probably damaging 1.00
R1496:Ano5 UTSW 7 51583775 missense probably damaging 1.00
R1512:Ano5 UTSW 7 51579568 missense probably benign 0.00
R1691:Ano5 UTSW 7 51590579 missense probably damaging 1.00
R1859:Ano5 UTSW 7 51546833 missense probably damaging 1.00
R1991:Ano5 UTSW 7 51537813 missense possibly damaging 0.59
R2066:Ano5 UTSW 7 51585386 missense probably damaging 1.00
R2088:Ano5 UTSW 7 51587706 missense possibly damaging 0.50
R2103:Ano5 UTSW 7 51537813 missense possibly damaging 0.59
R2248:Ano5 UTSW 7 51593789 missense probably benign 0.00
R3692:Ano5 UTSW 7 51590579 missense probably damaging 1.00
R3723:Ano5 UTSW 7 51576528 missense probably damaging 1.00
R3805:Ano5 UTSW 7 51576650 missense probably benign 0.22
R3883:Ano5 UTSW 7 51566304 missense probably damaging 1.00
R3978:Ano5 UTSW 7 51587806 missense probably benign
R4035:Ano5 UTSW 7 51566485 splice site probably benign
R4239:Ano5 UTSW 7 51587666 missense probably damaging 0.99
R4466:Ano5 UTSW 7 51570275 missense probably damaging 1.00
R4644:Ano5 UTSW 7 51587685 nonsense probably null
R5021:Ano5 UTSW 7 51556185 missense probably benign
R5028:Ano5 UTSW 7 51537710 splice site probably null
R5609:Ano5 UTSW 7 51593637 missense probably damaging 1.00
R5659:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5660:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5680:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5786:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5787:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5788:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5856:Ano5 UTSW 7 51585326 missense probably benign 0.01
R5930:Ano5 UTSW 7 51585331 missense probably damaging 0.99
R5984:Ano5 UTSW 7 51593664 missense probably damaging 1.00
R6015:Ano5 UTSW 7 51574777 missense probably benign 0.00
R6030:Ano5 UTSW 7 51574825 missense probably damaging 1.00
R6247:Ano5 UTSW 7 51566131 intron probably null
R7552:Ano5 UTSW 7 51546780 missense probably benign 0.31
R7559:Ano5 UTSW 7 51574888 missense probably damaging 1.00
X0062:Ano5 UTSW 7 51593651 nonsense probably null
X0065:Ano5 UTSW 7 51576628 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAGCTGCTGGGCAAATATAAC -3'
(R):5'- ATTGATCCCTTCAGATGTCAACAAC -3'

Sequencing Primer
(F):5'- TGGCGCATCCAGTGAGTCTC -3'
(R):5'- TCAACAACATAATAGGAGAGGGATC -3'
Posted On2017-08-16