Incidental Mutation 'R6030:Nlrx1'
ID486206
Institutional Source Beutler Lab
Gene Symbol Nlrx1
Ensembl Gene ENSMUSG00000032109
Gene NameNLR family member X1
Synonyms
MMRRC Submission 044202-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6030 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44252717-44268599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44263760 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 240 (V240M)
Ref Sequence ENSEMBL: ENSMUSP00000126555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034621] [ENSMUST00000168499] [ENSMUST00000169651] [ENSMUST00000213803] [ENSMUST00000217465]
Predicted Effect probably damaging
Transcript: ENSMUST00000034621
AA Change: V240M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034621
Gene: ENSMUSG00000032109
AA Change: V240M

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.1e-22 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168499
AA Change: V240M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127531
Gene: ENSMUSG00000032109
AA Change: V240M

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169651
AA Change: V240M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126555
Gene: ENSMUSG00000032109
AA Change: V240M

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213764
Predicted Effect probably benign
Transcript: ENSMUST00000213803
Predicted Effect probably benign
Transcript: ENSMUST00000217465
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,255,733 W59R probably damaging Het
Abca16 A G 7: 120,533,798 N1317D probably benign Het
Abhd8 T A 8: 71,458,150 Y338F possibly damaging Het
Actg2 G T 6: 83,516,364 N297K probably damaging Het
Agap1 A G 1: 89,630,434 D148G probably damaging Het
Alox12 T C 11: 70,254,591 D52G possibly damaging Het
Ano5 T A 7: 51,574,825 S496T probably damaging Het
Arl6ip4 T C 5: 124,117,905 probably null Het
Atp4a G C 7: 30,722,516 E826Q probably damaging Het
Bbs7 T C 3: 36,602,911 D256G probably damaging Het
Bckdha T A 7: 25,631,441 D50V probably damaging Het
Cast A G 13: 74,695,937 S693P possibly damaging Het
Col6a1 T C 10: 76,709,866 Y924C unknown Het
Crkl A G 16: 17,452,740 Y88C probably damaging Het
Cse1l T C 2: 166,919,621 F32L probably benign Het
Dmxl2 C T 9: 54,393,673 V2385I probably benign Het
Dnah1 T A 14: 31,268,027 I3219F probably damaging Het
Dnah17 C T 11: 118,025,549 R4266H probably benign Het
Efcab5 A G 11: 77,121,262 L722P probably damaging Het
Emilin3 C A 2: 160,909,185 V215L probably benign Het
Esr1 A T 10: 4,746,622 N157I possibly damaging Het
Esrrg A G 1: 188,198,707 M309V probably benign Het
Fam120b G A 17: 15,401,910 R50Q probably damaging Het
Fat2 G T 11: 55,310,303 Y648* probably null Het
Gbp2b T A 3: 142,603,653 I175N probably benign Het
Gm1043 T A 5: 37,154,608 probably benign Het
Gm21060 A G 19: 61,296,973 C33R possibly damaging Het
Gm9803 C T 10: 43,524,256 A30V probably benign Het
Gpx6 C T 13: 21,312,340 S28L probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifi44 T C 3: 151,749,558 Q10R probably benign Het
Impa2 T C 18: 67,318,428 V264A probably benign Het
Khdc1a A T 1: 21,350,884 M98L probably benign Het
Lrrc45 T A 11: 120,720,648 L616* probably null Het
Mios A T 6: 8,215,704 H300L probably benign Het
Mllt6 A T 11: 97,677,225 T827S probably damaging Het
Mrc1 C A 2: 14,316,901 D1068E probably benign Het
Ndst3 T C 3: 123,552,519 Y702C probably damaging Het
Nek11 T A 9: 105,204,888 probably null Het
Nek4 T C 14: 30,956,933 F138S probably damaging Het
Nfatc4 T A 14: 55,832,440 Y688* probably null Het
Npy6r A T 18: 44,276,082 Y190F probably benign Het
Olfr338 T G 2: 36,377,544 L256R probably damaging Het
Olfr472 A G 7: 107,903,413 E232G probably benign Het
Olfr509 A C 7: 108,646,226 S117A possibly damaging Het
Olfr548-ps1 C A 7: 102,542,610 R225S probably benign Het
Olfr780 A T 10: 129,322,369 T249S probably benign Het
Olfr960 T C 9: 39,623,341 F71L probably damaging Het
Osbpl7 A C 11: 97,052,261 H113P probably benign Het
Pck1 A G 2: 173,154,857 E188G probably benign Het
Pimreg A G 11: 72,045,750 D213G probably benign Het
Pkd1l2 A G 8: 117,043,237 I1160T probably damaging Het
Ppargc1b G A 18: 61,307,934 Q622* probably null Het
Ppfia2 T A 10: 106,906,477 C1044S probably damaging Het
Ppp4r3a A G 12: 101,058,400 V280A probably damaging Het
Ptprf T C 4: 118,211,048 N1764D probably benign Het
Pygm C T 19: 6,388,812 R311C possibly damaging Het
Rab7b A G 1: 131,698,561 K109R probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Sdccag3 T C 2: 26,386,971 D249G possibly damaging Het
Setbp1 T G 18: 78,857,711 I914L probably benign Het
Shprh A C 10: 11,151,991 Q114P probably benign Het
Slc5a9 T C 4: 111,885,528 I456V possibly damaging Het
Slc8b1 T C 5: 120,519,920 probably null Het
Spin1 T A 13: 51,139,516 Y87* probably null Het
Srebf2 T C 15: 82,177,276 probably null Het
Sufu T C 19: 46,475,539 Y397H probably damaging Het
Tgfb3 A C 12: 86,063,850 V242G probably benign Het
Tgm3 A T 2: 130,042,000 Y526F probably damaging Het
Tmem209 A G 6: 30,482,968 L508P probably damaging Het
Tmem67 T C 4: 12,063,799 D454G probably benign Het
Ttn T C 2: 76,816,599 E3280G possibly damaging Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Umps A G 16: 33,962,138 V138A probably benign Het
Wdr66 C T 5: 123,274,204 T532M probably damaging Het
Ypel1 A G 16: 17,084,513 probably null Het
Zdhhc19 T A 16: 32,499,042 L63Q probably null Het
Other mutations in Nlrx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nlrx1 APN 9 44253279 missense probably damaging 0.96
IGL00233:Nlrx1 APN 9 44264068 missense probably benign 0.37
IGL02388:Nlrx1 APN 9 44264005 missense probably benign 0.09
IGL02450:Nlrx1 APN 9 44253501 missense probably benign
IGL03353:Nlrx1 APN 9 44256593 missense probably benign
R0180:Nlrx1 UTSW 9 44255459 missense possibly damaging 0.95
R0416:Nlrx1 UTSW 9 44262914 missense probably benign
R1478:Nlrx1 UTSW 9 44264077 missense probably benign 0.04
R1762:Nlrx1 UTSW 9 44263640 missense possibly damaging 0.49
R1921:Nlrx1 UTSW 9 44254134 nonsense probably null
R1972:Nlrx1 UTSW 9 44253456 missense probably benign 0.01
R2050:Nlrx1 UTSW 9 44262780 missense probably damaging 1.00
R2100:Nlrx1 UTSW 9 44262608 missense probably damaging 1.00
R3967:Nlrx1 UTSW 9 44255425 splice site probably benign
R3968:Nlrx1 UTSW 9 44255425 splice site probably benign
R3969:Nlrx1 UTSW 9 44255425 splice site probably benign
R4898:Nlrx1 UTSW 9 44256897 missense probably benign
R4951:Nlrx1 UTSW 9 44253429 missense possibly damaging 0.81
R4956:Nlrx1 UTSW 9 44262612 nonsense probably null
R4959:Nlrx1 UTSW 9 44254151 missense possibly damaging 0.79
R5235:Nlrx1 UTSW 9 44263750 missense probably damaging 0.99
R5536:Nlrx1 UTSW 9 44263886 missense probably damaging 1.00
R6030:Nlrx1 UTSW 9 44263760 missense probably damaging 1.00
R6698:Nlrx1 UTSW 9 44265807 missense probably damaging 1.00
R7130:Nlrx1 UTSW 9 44262341 missense possibly damaging 0.83
R7253:Nlrx1 UTSW 9 44264704 splice site probably null
R7457:Nlrx1 UTSW 9 44256510 missense probably benign 0.28
X0023:Nlrx1 UTSW 9 44256563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCATTGGACAGGTTAAGG -3'
(R):5'- TACTGGCAAGAGCACGTTGG -3'

Sequencing Primer
(F):5'- CCCATTGGACAGGTTAAGGAACAG -3'
(R):5'- TGGTACGGAAGATGGTCTTAGAC -3'
Posted On2017-08-16