Incidental Mutation 'R6030:Ppargc1b'
ID486238
Institutional Source Beutler Lab
Gene Symbol Ppargc1b
Ensembl Gene ENSMUSG00000033871
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator 1 beta
SynonymsPGC-1beta/ERRL1, 4631412G21Rik
MMRRC Submission 044202-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R6030 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location61298136-61400431 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 61307934 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 622 (Q622*)
Ref Sequence ENSEMBL: ENSMUSP00000074771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063307] [ENSMUST00000075299]
Predicted Effect probably null
Transcript: ENSMUST00000063307
AA Change: Q638*
SMART Domains Protein: ENSMUSP00000069431
Gene: ENSMUSG00000033871
AA Change: Q638*

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 107 112 N/A INTRINSIC
low complexity region 137 156 N/A INTRINSIC
low complexity region 169 189 N/A INTRINSIC
coiled coil region 437 472 N/A INTRINSIC
low complexity region 613 619 N/A INTRINSIC
low complexity region 640 656 N/A INTRINSIC
low complexity region 799 833 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
RRM 910 980 8.87e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000075299
AA Change: Q622*
SMART Domains Protein: ENSMUSP00000074771
Gene: ENSMUSG00000033871
AA Change: Q622*

DomainStartEndE-ValueType
low complexity region 91 96 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 153 173 N/A INTRINSIC
coiled coil region 421 456 N/A INTRINSIC
low complexity region 597 603 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 783 817 N/A INTRINSIC
low complexity region 836 856 N/A INTRINSIC
RRM 894 964 8.87e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene stimulates the activity of several transcription factors and nuclear receptors, including estrogen receptor alpha, nuclear respiratory factor 1, and glucocorticoid receptor. The encoded protein may be involved in fat oxidation, non-oxidative glucose metabolism, and the regulation of energy expenditure. This protein is downregulated in prediabetic and type 2 diabetes mellitus patients. Certain allelic variations in this gene increase the risk of the development of obesity. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous inactivation of this gene can lead to postnatal lethality and impaired mitochondrial activity, adaptive thermogenesis, and hepatic function. Homozygotes for a null allele also display a defect in heart rate regulation, reduced body weight and WAT content, and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,255,733 W59R probably damaging Het
Abca16 A G 7: 120,533,798 N1317D probably benign Het
Abhd8 T A 8: 71,458,150 Y338F possibly damaging Het
Actg2 G T 6: 83,516,364 N297K probably damaging Het
Agap1 A G 1: 89,630,434 D148G probably damaging Het
Alox12 T C 11: 70,254,591 D52G possibly damaging Het
Ano5 T A 7: 51,574,825 S496T probably damaging Het
Arl6ip4 T C 5: 124,117,905 probably null Het
Atp4a G C 7: 30,722,516 E826Q probably damaging Het
Bbs7 T C 3: 36,602,911 D256G probably damaging Het
Bckdha T A 7: 25,631,441 D50V probably damaging Het
Cast A G 13: 74,695,937 S693P possibly damaging Het
Col6a1 T C 10: 76,709,866 Y924C unknown Het
Crkl A G 16: 17,452,740 Y88C probably damaging Het
Cse1l T C 2: 166,919,621 F32L probably benign Het
Dmxl2 C T 9: 54,393,673 V2385I probably benign Het
Dnah1 T A 14: 31,268,027 I3219F probably damaging Het
Dnah17 C T 11: 118,025,549 R4266H probably benign Het
Efcab5 A G 11: 77,121,262 L722P probably damaging Het
Emilin3 C A 2: 160,909,185 V215L probably benign Het
Esr1 A T 10: 4,746,622 N157I possibly damaging Het
Esrrg A G 1: 188,198,707 M309V probably benign Het
Fam120b G A 17: 15,401,910 R50Q probably damaging Het
Fat2 G T 11: 55,310,303 Y648* probably null Het
Gbp2b T A 3: 142,603,653 I175N probably benign Het
Gm1043 T A 5: 37,154,608 probably benign Het
Gm21060 A G 19: 61,296,973 C33R possibly damaging Het
Gm9803 C T 10: 43,524,256 A30V probably benign Het
Gpx6 C T 13: 21,312,340 S28L probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifi44 T C 3: 151,749,558 Q10R probably benign Het
Impa2 T C 18: 67,318,428 V264A probably benign Het
Khdc1a A T 1: 21,350,884 M98L probably benign Het
Lrrc45 T A 11: 120,720,648 L616* probably null Het
Mios A T 6: 8,215,704 H300L probably benign Het
Mllt6 A T 11: 97,677,225 T827S probably damaging Het
Mrc1 C A 2: 14,316,901 D1068E probably benign Het
Ndst3 T C 3: 123,552,519 Y702C probably damaging Het
Nek11 T A 9: 105,204,888 probably null Het
Nek4 T C 14: 30,956,933 F138S probably damaging Het
Nfatc4 T A 14: 55,832,440 Y688* probably null Het
Nlrx1 C T 9: 44,263,760 V240M probably damaging Het
Npy6r A T 18: 44,276,082 Y190F probably benign Het
Olfr338 T G 2: 36,377,544 L256R probably damaging Het
Olfr472 A G 7: 107,903,413 E232G probably benign Het
Olfr509 A C 7: 108,646,226 S117A possibly damaging Het
Olfr548-ps1 C A 7: 102,542,610 R225S probably benign Het
Olfr780 A T 10: 129,322,369 T249S probably benign Het
Olfr960 T C 9: 39,623,341 F71L probably damaging Het
Osbpl7 A C 11: 97,052,261 H113P probably benign Het
Pck1 A G 2: 173,154,857 E188G probably benign Het
Pimreg A G 11: 72,045,750 D213G probably benign Het
Pkd1l2 A G 8: 117,043,237 I1160T probably damaging Het
Ppfia2 T A 10: 106,906,477 C1044S probably damaging Het
Ppp4r3a A G 12: 101,058,400 V280A probably damaging Het
Ptprf T C 4: 118,211,048 N1764D probably benign Het
Pygm C T 19: 6,388,812 R311C possibly damaging Het
Rab7b A G 1: 131,698,561 K109R probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Sdccag3 T C 2: 26,386,971 D249G possibly damaging Het
Setbp1 T G 18: 78,857,711 I914L probably benign Het
Shprh A C 10: 11,151,991 Q114P probably benign Het
Slc5a9 T C 4: 111,885,528 I456V possibly damaging Het
Slc8b1 T C 5: 120,519,920 probably null Het
Spin1 T A 13: 51,139,516 Y87* probably null Het
Srebf2 T C 15: 82,177,276 probably null Het
Sufu T C 19: 46,475,539 Y397H probably damaging Het
Tgfb3 A C 12: 86,063,850 V242G probably benign Het
Tgm3 A T 2: 130,042,000 Y526F probably damaging Het
Tmem209 A G 6: 30,482,968 L508P probably damaging Het
Tmem67 T C 4: 12,063,799 D454G probably benign Het
Ttn T C 2: 76,816,599 E3280G possibly damaging Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Umps A G 16: 33,962,138 V138A probably benign Het
Wdr66 C T 5: 123,274,204 T532M probably damaging Het
Ypel1 A G 16: 17,084,513 probably null Het
Zdhhc19 T A 16: 32,499,042 L63Q probably null Het
Other mutations in Ppargc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ppargc1b APN 18 61323164 missense probably damaging 1.00
IGL02160:Ppargc1b APN 18 61310435 missense probably damaging 1.00
IGL02176:Ppargc1b APN 18 61310875 nonsense probably null
IGL02176:Ppargc1b APN 18 61310874 missense probably damaging 1.00
IGL02183:Ppargc1b APN 18 61309096 critical splice acceptor site probably null
IGL02386:Ppargc1b APN 18 61323151 missense probably damaging 1.00
IGL02620:Ppargc1b APN 18 61298739 missense probably damaging 1.00
IGL02688:Ppargc1b APN 18 61312243 missense possibly damaging 0.94
IGL02801:Ppargc1b APN 18 61307684 missense possibly damaging 0.77
IGL02970:Ppargc1b APN 18 61298766 missense probably damaging 1.00
R0033:Ppargc1b UTSW 18 61307694 missense probably damaging 1.00
R0139:Ppargc1b UTSW 18 61315963 splice site probably benign
R0194:Ppargc1b UTSW 18 61307945 missense possibly damaging 0.94
R0412:Ppargc1b UTSW 18 61315861 missense probably damaging 0.99
R0574:Ppargc1b UTSW 18 61302739 missense probably benign 0.34
R0576:Ppargc1b UTSW 18 61311441 missense probably damaging 0.98
R1546:Ppargc1b UTSW 18 61310606 missense probably damaging 1.00
R1721:Ppargc1b UTSW 18 61307204 splice site probably null
R1758:Ppargc1b UTSW 18 61298786 splice site probably null
R1951:Ppargc1b UTSW 18 61298777 missense possibly damaging 0.55
R2110:Ppargc1b UTSW 18 61311250 missense probably benign 0.00
R2112:Ppargc1b UTSW 18 61311250 missense probably benign 0.00
R2212:Ppargc1b UTSW 18 61311220 nonsense probably null
R2432:Ppargc1b UTSW 18 61307799 missense possibly damaging 0.93
R3612:Ppargc1b UTSW 18 61310556 missense probably benign 0.07
R3848:Ppargc1b UTSW 18 61311042 missense probably damaging 1.00
R3913:Ppargc1b UTSW 18 61311376 missense probably damaging 0.99
R4328:Ppargc1b UTSW 18 61382469 nonsense probably null
R4502:Ppargc1b UTSW 18 61302679 missense probably benign 0.39
R4762:Ppargc1b UTSW 18 61311257 missense possibly damaging 0.93
R5032:Ppargc1b UTSW 18 61307265 missense probably damaging 1.00
R5111:Ppargc1b UTSW 18 61310487 missense probably damaging 1.00
R5119:Ppargc1b UTSW 18 61307654 missense probably benign 0.38
R5164:Ppargc1b UTSW 18 61302644 missense probably damaging 1.00
R5266:Ppargc1b UTSW 18 61315805 missense probably damaging 1.00
R5350:Ppargc1b UTSW 18 61309063 missense possibly damaging 0.78
R5478:Ppargc1b UTSW 18 61307568 missense probably benign
R5719:Ppargc1b UTSW 18 61307568 missense probably benign
R5876:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5877:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5879:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5967:Ppargc1b UTSW 18 61298766 missense probably damaging 1.00
R6030:Ppargc1b UTSW 18 61307934 nonsense probably null
R6135:Ppargc1b UTSW 18 61315909 missense probably damaging 0.99
R6533:Ppargc1b UTSW 18 61307774 missense possibly damaging 0.93
R6791:Ppargc1b UTSW 18 61307676 missense probably damaging 1.00
R6792:Ppargc1b UTSW 18 61307676 missense probably damaging 1.00
R7033:Ppargc1b UTSW 18 61307714 missense probably damaging 0.96
R7316:Ppargc1b UTSW 18 61307838 missense probably damaging 0.97
R7560:Ppargc1b UTSW 18 61312210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTAGTCGTGGTCTCCAAAG -3'
(R):5'- AGTGATTCGAAGCCACCCAC -3'

Sequencing Primer
(F):5'- CTCCAAAGGAGCAGGAGAAG -3'
(R):5'- CTATAAGGGATCTTGTGACCCACG -3'
Posted On2017-08-16