Incidental Mutation 'R6030:Pygm'
ID486241
Institutional Source Beutler Lab
Gene Symbol Pygm
Ensembl Gene ENSMUSG00000032648
Gene Namemuscle glycogen phosphorylase
SynonymsPG
MMRRC Submission 044202-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6030 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6384399-6398459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6388812 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 311 (R311C)
Ref Sequence ENSEMBL: ENSMUSP00000047564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035269] [ENSMUST00000113483]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035269
AA Change: R311C

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047564
Gene: ENSMUSG00000032648
AA Change: R311C

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113483
AA Change: R223C

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109111
Gene: ENSMUSG00000032648
AA Change: R223C

DomainStartEndE-ValueType
Pfam:Phosphorylase 62 742 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142755
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycolysis enzyme found in muscle. Highly similar enzymes encoded by different genes are found in liver and brain. The encoded protein is involved in regulating the breakdown of glycogen to glucose-1-phosphate, which is necessary for ATP generation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation exhibit massive muscle glycogen accumulation, elevated creatine kinase levels in blood, and very poor exercise performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,255,733 W59R probably damaging Het
Abca16 A G 7: 120,533,798 N1317D probably benign Het
Abhd8 T A 8: 71,458,150 Y338F possibly damaging Het
Actg2 G T 6: 83,516,364 N297K probably damaging Het
Agap1 A G 1: 89,630,434 D148G probably damaging Het
Alox12 T C 11: 70,254,591 D52G possibly damaging Het
Ano5 T A 7: 51,574,825 S496T probably damaging Het
Arl6ip4 T C 5: 124,117,905 probably null Het
Atp4a G C 7: 30,722,516 E826Q probably damaging Het
Bbs7 T C 3: 36,602,911 D256G probably damaging Het
Bckdha T A 7: 25,631,441 D50V probably damaging Het
Cast A G 13: 74,695,937 S693P possibly damaging Het
Col6a1 T C 10: 76,709,866 Y924C unknown Het
Crkl A G 16: 17,452,740 Y88C probably damaging Het
Cse1l T C 2: 166,919,621 F32L probably benign Het
Dmxl2 C T 9: 54,393,673 V2385I probably benign Het
Dnah1 T A 14: 31,268,027 I3219F probably damaging Het
Dnah17 C T 11: 118,025,549 R4266H probably benign Het
Efcab5 A G 11: 77,121,262 L722P probably damaging Het
Emilin3 C A 2: 160,909,185 V215L probably benign Het
Esr1 A T 10: 4,746,622 N157I possibly damaging Het
Esrrg A G 1: 188,198,707 M309V probably benign Het
Fam120b G A 17: 15,401,910 R50Q probably damaging Het
Fat2 G T 11: 55,310,303 Y648* probably null Het
Gbp2b T A 3: 142,603,653 I175N probably benign Het
Gm1043 T A 5: 37,154,608 probably benign Het
Gm21060 A G 19: 61,296,973 C33R possibly damaging Het
Gm9803 C T 10: 43,524,256 A30V probably benign Het
Gpx6 C T 13: 21,312,340 S28L probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifi44 T C 3: 151,749,558 Q10R probably benign Het
Impa2 T C 18: 67,318,428 V264A probably benign Het
Khdc1a A T 1: 21,350,884 M98L probably benign Het
Lrrc45 T A 11: 120,720,648 L616* probably null Het
Mios A T 6: 8,215,704 H300L probably benign Het
Mllt6 A T 11: 97,677,225 T827S probably damaging Het
Mrc1 C A 2: 14,316,901 D1068E probably benign Het
Ndst3 T C 3: 123,552,519 Y702C probably damaging Het
Nek11 T A 9: 105,204,888 probably null Het
Nek4 T C 14: 30,956,933 F138S probably damaging Het
Nfatc4 T A 14: 55,832,440 Y688* probably null Het
Nlrx1 C T 9: 44,263,760 V240M probably damaging Het
Npy6r A T 18: 44,276,082 Y190F probably benign Het
Olfr338 T G 2: 36,377,544 L256R probably damaging Het
Olfr472 A G 7: 107,903,413 E232G probably benign Het
Olfr509 A C 7: 108,646,226 S117A possibly damaging Het
Olfr548-ps1 C A 7: 102,542,610 R225S probably benign Het
Olfr780 A T 10: 129,322,369 T249S probably benign Het
Olfr960 T C 9: 39,623,341 F71L probably damaging Het
Osbpl7 A C 11: 97,052,261 H113P probably benign Het
Pck1 A G 2: 173,154,857 E188G probably benign Het
Pimreg A G 11: 72,045,750 D213G probably benign Het
Pkd1l2 A G 8: 117,043,237 I1160T probably damaging Het
Ppargc1b G A 18: 61,307,934 Q622* probably null Het
Ppfia2 T A 10: 106,906,477 C1044S probably damaging Het
Ppp4r3a A G 12: 101,058,400 V280A probably damaging Het
Ptprf T C 4: 118,211,048 N1764D probably benign Het
Rab7b A G 1: 131,698,561 K109R probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Sdccag3 T C 2: 26,386,971 D249G possibly damaging Het
Setbp1 T G 18: 78,857,711 I914L probably benign Het
Shprh A C 10: 11,151,991 Q114P probably benign Het
Slc5a9 T C 4: 111,885,528 I456V possibly damaging Het
Slc8b1 T C 5: 120,519,920 probably null Het
Spin1 T A 13: 51,139,516 Y87* probably null Het
Srebf2 T C 15: 82,177,276 probably null Het
Sufu T C 19: 46,475,539 Y397H probably damaging Het
Tgfb3 A C 12: 86,063,850 V242G probably benign Het
Tgm3 A T 2: 130,042,000 Y526F probably damaging Het
Tmem209 A G 6: 30,482,968 L508P probably damaging Het
Tmem67 T C 4: 12,063,799 D454G probably benign Het
Ttn T C 2: 76,816,599 E3280G possibly damaging Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Umps A G 16: 33,962,138 V138A probably benign Het
Wdr66 C T 5: 123,274,204 T532M probably damaging Het
Ypel1 A G 16: 17,084,513 probably null Het
Zdhhc19 T A 16: 32,499,042 L63Q probably null Het
Other mutations in Pygm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Pygm APN 19 6391394 missense probably benign
IGL01743:Pygm APN 19 6392994 splice site probably null
IGL01827:Pygm APN 19 6390377 missense probably damaging 1.00
IGL02032:Pygm APN 19 6388087 missense probably benign 0.23
IGL02261:Pygm APN 19 6388271 missense probably damaging 1.00
IGL02431:Pygm APN 19 6388118 missense probably damaging 1.00
IGL02511:Pygm APN 19 6385688 missense probably benign 0.22
IGL02967:Pygm APN 19 6393838 missense probably damaging 1.00
IGL03081:Pygm APN 19 6388821 missense possibly damaging 0.53
R0336:Pygm UTSW 19 6388758 missense probably damaging 1.00
R0415:Pygm UTSW 19 6391366 missense probably benign 0.06
R0799:Pygm UTSW 19 6386018 intron probably benign
R1445:Pygm UTSW 19 6389887 missense probably benign 0.20
R1752:Pygm UTSW 19 6391034 missense probably damaging 0.99
R1828:Pygm UTSW 19 6397607 missense possibly damaging 0.72
R2054:Pygm UTSW 19 6388155 missense probably benign 0.02
R2086:Pygm UTSW 19 6391481 critical splice donor site probably null
R2116:Pygm UTSW 19 6386408 missense probably damaging 0.98
R2431:Pygm UTSW 19 6393785 missense probably damaging 1.00
R2516:Pygm UTSW 19 6397601 missense probably benign 0.20
R3938:Pygm UTSW 19 6392950 missense probably benign 0.42
R4609:Pygm UTSW 19 6391409 missense possibly damaging 0.92
R4924:Pygm UTSW 19 6393724 missense probably damaging 1.00
R4995:Pygm UTSW 19 6398139 missense probably damaging 1.00
R5225:Pygm UTSW 19 6389464 missense probably benign 0.01
R5296:Pygm UTSW 19 6384579 missense probably damaging 1.00
R5437:Pygm UTSW 19 6390382 missense probably damaging 1.00
R5994:Pygm UTSW 19 6398043 critical splice acceptor site probably null
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6188:Pygm UTSW 19 6397937 splice site probably null
R6266:Pygm UTSW 19 6398139 missense probably damaging 1.00
R6799:Pygm UTSW 19 6398127 missense probably damaging 1.00
R6855:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6856:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6857:Pygm UTSW 19 6393757 missense probably damaging 1.00
R7223:Pygm UTSW 19 6388863 missense probably benign
R7256:Pygm UTSW 19 6385896 missense probably benign 0.01
R7263:Pygm UTSW 19 6388327 missense probably damaging 1.00
R7398:Pygm UTSW 19 6385936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTTGGTGGGGCAAAGACC -3'
(R):5'- AAGATCCTGAGCTGAGCAAG -3'

Sequencing Primer
(F):5'- CCCTGGGTCCAGAAGGTG -3'
(R):5'- TGAGCAAGCCATCTCCCC -3'
Posted On2017-08-16