Incidental Mutation 'R6031:Atg7'
ID486271
Institutional Source Beutler Lab
Gene Symbol Atg7
Ensembl Gene ENSMUSG00000030314
Gene Nameautophagy related 7
Synonyms1810013K23Rik, Apg7l
MMRRC Submission 044203-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6031 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location114643097-114860614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114671233 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 31 (C31S)
Ref Sequence ENSEMBL: ENSMUSP00000133215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032457] [ENSMUST00000169310] [ENSMUST00000182034] [ENSMUST00000182035] [ENSMUST00000182098] [ENSMUST00000182169] [ENSMUST00000182428] [ENSMUST00000182510] [ENSMUST00000182771] [ENSMUST00000182793] [ENSMUST00000182902] [ENSMUST00000183165]
Predicted Effect probably benign
Transcript: ENSMUST00000032457
SMART Domains Protein: ENSMUSP00000032457
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169310
AA Change: C31S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000133215
Gene: ENSMUSG00000030314
AA Change: C31S

DomainStartEndE-ValueType
Pfam:ATG7_N 9 319 1.5e-106 PFAM
Pfam:ThiF 329 643 7.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182034
SMART Domains Protein: ENSMUSP00000138358
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 25 231 1e-39 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182035
SMART Domains Protein: ENSMUSP00000138731
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 9 222 9e-40 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182098
Predicted Effect probably benign
Transcript: ENSMUST00000182169
SMART Domains Protein: ENSMUSP00000138404
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 32 110 2e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182428
SMART Domains Protein: ENSMUSP00000138779
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182510
SMART Domains Protein: ENSMUSP00000138300
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 9 159 8e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182771
SMART Domains Protein: ENSMUSP00000138374
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 9 47 7e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182793
SMART Domains Protein: ENSMUSP00000138137
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182902
SMART Domains Protein: ENSMUSP00000138651
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183127
Predicted Effect probably benign
Transcript: ENSMUST00000183165
SMART Domains Protein: ENSMUSP00000138600
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 311 467 9.7e-38 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an E1-like activating enzyme that is essential for autophagy and cytoplasmic to vacuole transport. The encoded protein is also thought to modulate p53-dependent cell cycle pathways during prolonged metabolic stress. It has been associated with multiple functions, including axon membrane trafficking, axonal homeostasis, mitophagy, adipose differentiation, and hematopoietic stem cell maintenance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene causes impairment of constitutive and starvation-induced autophagy resulting in defective protein degradation. Homozygous null mice die within 1 day of birth and have decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,252 Y304H possibly damaging Het
Add2 A G 6: 86,098,673 E268G probably damaging Het
Akr1b3 A C 6: 34,312,674 V67G probably benign Het
Alms1 A T 6: 85,622,955 N1588Y probably damaging Het
Arhgap23 A T 11: 97,476,139 D1082V probably damaging Het
Asb6 A G 2: 30,824,195 V301A probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Camsap2 A T 1: 136,280,438 N1105K possibly damaging Het
Ccdc109b A G 3: 129,926,389 Y152H probably damaging Het
Ccdc125 C T 13: 100,684,369 probably null Het
Ccdc63 T C 5: 122,129,736 I56V possibly damaging Het
Cpd T C 11: 76,790,888 E1143G probably benign Het
Cpt1a T A 19: 3,371,556 probably null Het
Creb3l2 A T 6: 37,334,434 D473E probably benign Het
Disp2 G T 2: 118,789,794 V336L probably benign Het
Efr3b A G 12: 3,967,106 I782T possibly damaging Het
Fam98a A G 17: 75,539,432 V230A probably damaging Het
Fat3 T A 9: 15,988,492 T3082S probably benign Het
Frmd3 T C 4: 74,187,451 Y445H probably damaging Het
Galt G A 4: 41,757,202 R185Q probably benign Het
Gatb T C 3: 85,613,511 I309T possibly damaging Het
Gfi1b G A 2: 28,613,808 Q127* probably null Het
Gfpt1 C A 6: 87,086,320 T563N probably damaging Het
Gria1 A G 11: 57,217,782 D237G probably damaging Het
Hspbp1 A T 7: 4,663,466 V305D probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Iars T C 13: 49,705,831 V9A probably damaging Het
Ipo4 G A 14: 55,632,139 P355S probably damaging Het
Jade2 G T 11: 51,826,586 C314* probably null Het
Kri1 T C 9: 21,275,269 E597G probably benign Het
Med23 C T 10: 24,903,748 R542* probably null Het
Ndc80 T C 17: 71,511,488 N291S probably benign Het
Nop2 T C 6: 125,133,566 probably null Het
Nrxn1 T C 17: 90,588,790 N984S probably damaging Het
Ntm A C 9: 29,009,375 L86R probably damaging Het
Numa1 T A 7: 102,012,012 D1847E possibly damaging Het
Odf2l A G 3: 145,139,863 Q334R probably damaging Het
Olfr1238 T A 2: 89,406,972 T36S probably damaging Het
Olfr1333 A T 4: 118,830,391 probably null Het
Olfr199 T C 16: 59,215,933 R227G probably benign Het
Olfr522 A T 7: 140,162,809 V47E possibly damaging Het
Olfr706 C T 7: 106,885,927 V297I possibly damaging Het
Olfr772 A G 10: 129,174,355 V222A probably benign Het
Pcdhb19 A T 18: 37,497,723 K190N probably damaging Het
Pdik1l A G 4: 134,279,041 F197L probably damaging Het
Rnf113a2 T C 12: 84,417,990 F219L probably damaging Het
Rnf208 A C 2: 25,243,764 T157P probably damaging Het
RP23-145I16.3 A T 7: 142,376,714 C364S probably damaging Het
Scn8a A T 15: 100,983,984 D644V probably damaging Het
Thbs3 T A 3: 89,218,094 C204S probably damaging Het
Tlr3 A G 8: 45,398,528 I444T probably damaging Het
Tmem206 A G 1: 191,340,840 R153G probably benign Het
Trpm8 A T 1: 88,354,469 I696F possibly damaging Het
Ttn A T 2: 76,830,597 V7422D possibly damaging Het
Ufl1 A G 4: 25,278,038 V139A probably benign Het
Uggt2 A T 14: 119,070,826 V381D probably benign Het
Vgll3 T A 16: 65,839,481 Y173N probably damaging Het
Vmn1r9 A G 6: 57,071,173 T78A probably benign Het
Vps13b T A 15: 35,471,968 L806M probably damaging Het
Vps13d A C 4: 145,168,509 H394Q probably benign Het
Wdr53 T A 16: 32,256,718 V247D probably damaging Het
Wdr81 A T 11: 75,447,869 L1488Q probably damaging Het
Zc3h6 A G 2: 128,967,812 D3G possibly damaging Het
Zfp93 G T 7: 24,276,300 C570F probably damaging Het
Zfp943 C T 17: 21,993,376 T481I probably benign Het
Other mutations in Atg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02969:Atg7 APN 6 114724923 missense possibly damaging 0.71
R1460:Atg7 UTSW 6 114703364 missense probably damaging 0.99
R1467:Atg7 UTSW 6 114858982 splice site probably benign
R1561:Atg7 UTSW 6 114701172 missense possibly damaging 0.52
R1755:Atg7 UTSW 6 114673677 missense possibly damaging 0.64
R1934:Atg7 UTSW 6 114701235 missense probably damaging 0.98
R1962:Atg7 UTSW 6 114706230 missense probably damaging 1.00
R1964:Atg7 UTSW 6 114706230 missense probably damaging 1.00
R2064:Atg7 UTSW 6 114703363 missense probably damaging 1.00
R3722:Atg7 UTSW 6 114695663 missense probably damaging 0.99
R3870:Atg7 UTSW 6 114697047 missense possibly damaging 0.71
R3926:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R4044:Atg7 UTSW 6 114701978 missense probably benign 0.00
R4111:Atg7 UTSW 6 114713294 missense probably damaging 0.98
R4212:Atg7 UTSW 6 114703425 missense probably benign 0.02
R4943:Atg7 UTSW 6 114697084 missense probably benign 0.25
R5216:Atg7 UTSW 6 114724949 missense probably damaging 0.96
R5465:Atg7 UTSW 6 114652532 missense probably benign
R5555:Atg7 UTSW 6 114702053 missense probably damaging 1.00
R5618:Atg7 UTSW 6 114673699 missense probably damaging 0.99
R5902:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R5903:Atg7 UTSW 6 114706293 nonsense probably null
R5980:Atg7 UTSW 6 114680236 missense possibly damaging 0.80
R6031:Atg7 UTSW 6 114671233 missense probably benign 0.01
R6178:Atg7 UTSW 6 114724895 missense probably damaging 1.00
R6702:Atg7 UTSW 6 114671097 splice site probably null
R6924:Atg7 UTSW 6 114709211 critical splice donor site probably null
R6941:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R7201:Atg7 UTSW 6 114777057 missense probably damaging 1.00
Z1088:Atg7 UTSW 6 114695686 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ATAGACACATAGCCGGGCAC -3'
(R):5'- TCTGTGAACTACAAGCAACCCTG -3'

Sequencing Primer
(F):5'- CAGGCATAAGCAGCTCTTTG -3'
(R):5'- GTGAACTACAAGCAACCCTGTCTATG -3'
Posted On2017-08-16