Incidental Mutation 'R6031:Arhgap23'
ID486291
Institutional Source Beutler Lab
Gene Symbol Arhgap23
Ensembl Gene ENSMUSG00000049807
Gene NameRho GTPase activating protein 23
Synonyms
MMRRC Submission 044203-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6031 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location97415533-97502402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97476139 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1082 (D1082V)
Ref Sequence ENSEMBL: ENSMUSP00000112999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107601
AA Change: D871V

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807
AA Change: D871V

DomainStartEndE-ValueType
low complexity region 246 258 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 426 443 N/A INTRINSIC
PH 479 600 3.2e-12 SMART
low complexity region 679 687 N/A INTRINSIC
RhoGAP 707 884 6.83e-65 SMART
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1101 1114 N/A INTRINSIC
low complexity region 1125 1146 N/A INTRINSIC
low complexity region 1176 1194 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121799
AA Change: D1082V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: D1082V

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
PDZ 52 160 4.2e-17 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 637 654 N/A INTRINSIC
PH 690 811 3.2e-12 SMART
low complexity region 890 898 N/A INTRINSIC
RhoGAP 918 1095 6.83e-65 SMART
low complexity region 1262 1277 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
low complexity region 1336 1357 N/A INTRINSIC
low complexity region 1387 1405 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142465
AA Change: D571V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807
AA Change: D571V

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
PH 179 300 3.2e-12 SMART
low complexity region 379 387 N/A INTRINSIC
RhoGAP 407 584 6.83e-65 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,252 Y304H possibly damaging Het
Add2 A G 6: 86,098,673 E268G probably damaging Het
Akr1b3 A C 6: 34,312,674 V67G probably benign Het
Alms1 A T 6: 85,622,955 N1588Y probably damaging Het
Asb6 A G 2: 30,824,195 V301A probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Atg7 T A 6: 114,671,233 C31S probably benign Het
Camsap2 A T 1: 136,280,438 N1105K possibly damaging Het
Ccdc109b A G 3: 129,926,389 Y152H probably damaging Het
Ccdc125 C T 13: 100,684,369 probably null Het
Ccdc63 T C 5: 122,129,736 I56V possibly damaging Het
Cpd T C 11: 76,790,888 E1143G probably benign Het
Cpt1a T A 19: 3,371,556 probably null Het
Creb3l2 A T 6: 37,334,434 D473E probably benign Het
Disp2 G T 2: 118,789,794 V336L probably benign Het
Efr3b A G 12: 3,967,106 I782T possibly damaging Het
Fam98a A G 17: 75,539,432 V230A probably damaging Het
Fat3 T A 9: 15,988,492 T3082S probably benign Het
Frmd3 T C 4: 74,187,451 Y445H probably damaging Het
Galt G A 4: 41,757,202 R185Q probably benign Het
Gatb T C 3: 85,613,511 I309T possibly damaging Het
Gfi1b G A 2: 28,613,808 Q127* probably null Het
Gfpt1 C A 6: 87,086,320 T563N probably damaging Het
Gria1 A G 11: 57,217,782 D237G probably damaging Het
Hspbp1 A T 7: 4,663,466 V305D probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Iars T C 13: 49,705,831 V9A probably damaging Het
Ipo4 G A 14: 55,632,139 P355S probably damaging Het
Jade2 G T 11: 51,826,586 C314* probably null Het
Kri1 T C 9: 21,275,269 E597G probably benign Het
Med23 C T 10: 24,903,748 R542* probably null Het
Ndc80 T C 17: 71,511,488 N291S probably benign Het
Nop2 T C 6: 125,133,566 probably null Het
Nrxn1 T C 17: 90,588,790 N984S probably damaging Het
Ntm A C 9: 29,009,375 L86R probably damaging Het
Numa1 T A 7: 102,012,012 D1847E possibly damaging Het
Odf2l A G 3: 145,139,863 Q334R probably damaging Het
Olfr1238 T A 2: 89,406,972 T36S probably damaging Het
Olfr1333 A T 4: 118,830,391 probably null Het
Olfr199 T C 16: 59,215,933 R227G probably benign Het
Olfr522 A T 7: 140,162,809 V47E possibly damaging Het
Olfr706 C T 7: 106,885,927 V297I possibly damaging Het
Olfr772 A G 10: 129,174,355 V222A probably benign Het
Pcdhb19 A T 18: 37,497,723 K190N probably damaging Het
Pdik1l A G 4: 134,279,041 F197L probably damaging Het
Rnf113a2 T C 12: 84,417,990 F219L probably damaging Het
Rnf208 A C 2: 25,243,764 T157P probably damaging Het
RP23-145I16.3 A T 7: 142,376,714 C364S probably damaging Het
Scn8a A T 15: 100,983,984 D644V probably damaging Het
Thbs3 T A 3: 89,218,094 C204S probably damaging Het
Tlr3 A G 8: 45,398,528 I444T probably damaging Het
Tmem206 A G 1: 191,340,840 R153G probably benign Het
Trpm8 A T 1: 88,354,469 I696F possibly damaging Het
Ttn A T 2: 76,830,597 V7422D possibly damaging Het
Ufl1 A G 4: 25,278,038 V139A probably benign Het
Uggt2 A T 14: 119,070,826 V381D probably benign Het
Vgll3 T A 16: 65,839,481 Y173N probably damaging Het
Vmn1r9 A G 6: 57,071,173 T78A probably benign Het
Vps13b T A 15: 35,471,968 L806M probably damaging Het
Vps13d A C 4: 145,168,509 H394Q probably benign Het
Wdr53 T A 16: 32,256,718 V247D probably damaging Het
Wdr81 A T 11: 75,447,869 L1488Q probably damaging Het
Zc3h6 A G 2: 128,967,812 D3G possibly damaging Het
Zfp93 G T 7: 24,276,300 C570F probably damaging Het
Zfp943 C T 17: 21,993,376 T481I probably benign Het
Other mutations in Arhgap23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Arhgap23 APN 11 97492671 intron probably benign
IGL00493:Arhgap23 APN 11 97446553 critical splice donor site probably null
IGL01729:Arhgap23 APN 11 97453961 missense probably damaging 1.00
IGL01805:Arhgap23 APN 11 97492602 intron probably benign
IGL02005:Arhgap23 APN 11 97491219 missense probably damaging 0.99
IGL02026:Arhgap23 APN 11 97451581 missense probably damaging 0.99
IGL02135:Arhgap23 APN 11 97451702 missense probably damaging 0.97
IGL02178:Arhgap23 APN 11 97452353 missense probably benign 0.42
IGL02226:Arhgap23 APN 11 97451600 missense probably benign 0.07
IGL02309:Arhgap23 APN 11 97466001 splice site probably benign
IGL02399:Arhgap23 APN 11 97491005 intron probably benign
IGL02630:Arhgap23 APN 11 97454297 missense probably benign 0.24
IGL02724:Arhgap23 APN 11 97491179 missense probably damaging 0.99
IGL02740:Arhgap23 APN 11 97475017 missense probably damaging 1.00
IGL02746:Arhgap23 APN 11 97454204 splice site probably benign
IGL02862:Arhgap23 APN 11 97456480 missense probably damaging 1.00
IGL03380:Arhgap23 APN 11 97452518 missense probably damaging 1.00
R0091:Arhgap23 UTSW 11 97452244 missense probably benign 0.44
R0134:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0225:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0305:Arhgap23 UTSW 11 97501109 missense probably damaging 0.99
R0358:Arhgap23 UTSW 11 97463588 missense probably damaging 1.00
R0422:Arhgap23 UTSW 11 97463652 missense probably damaging 1.00
R0497:Arhgap23 UTSW 11 97452163 missense probably damaging 1.00
R0580:Arhgap23 UTSW 11 97446536 frame shift probably null
R0782:Arhgap23 UTSW 11 97500554 missense possibly damaging 0.73
R1216:Arhgap23 UTSW 11 97492672 intron probably benign
R1488:Arhgap23 UTSW 11 97500859 missense possibly damaging 0.53
R1785:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R1844:Arhgap23 UTSW 11 97463408 missense probably damaging 1.00
R1855:Arhgap23 UTSW 11 97448697 missense probably damaging 0.99
R1977:Arhgap23 UTSW 11 97451447 missense possibly damaging 0.95
R2064:Arhgap23 UTSW 11 97493062 missense probably benign 0.02
R2130:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R2431:Arhgap23 UTSW 11 97452404 missense probably benign
R2853:Arhgap23 UTSW 11 97492594 splice site probably null
R3767:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3768:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3769:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3770:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R4209:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R4247:Arhgap23 UTSW 11 97463699 missense probably damaging 1.00
R4997:Arhgap23 UTSW 11 97452020 missense probably damaging 0.98
R5399:Arhgap23 UTSW 11 97500917 missense probably damaging 0.97
R5549:Arhgap23 UTSW 11 97466568 missense probably damaging 0.96
R5655:Arhgap23 UTSW 11 97452546 critical splice donor site probably null
R5857:Arhgap23 UTSW 11 97451579 missense possibly damaging 0.93
R6013:Arhgap23 UTSW 11 97500992 missense probably damaging 0.99
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6077:Arhgap23 UTSW 11 97491232 critical splice donor site probably null
R6151:Arhgap23 UTSW 11 97500412 missense probably benign 0.01
R6393:Arhgap23 UTSW 11 97463672 missense probably damaging 0.98
R6693:Arhgap23 UTSW 11 97466517 missense probably damaging 1.00
R6752:Arhgap23 UTSW 11 97452248 missense probably damaging 0.98
R7202:Arhgap23 UTSW 11 97451993 missense possibly damaging 0.65
R7209:Arhgap23 UTSW 11 97476085 missense probably damaging 1.00
R7320:Arhgap23 UTSW 11 97451545 missense probably benign 0.10
V8831:Arhgap23 UTSW 11 97456545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATGTGAGATGTCTGACCC -3'
(R):5'- TTGATGGCAGCCTGTCACTG -3'

Sequencing Primer
(F):5'- CCACTCTAAGGACATGTCAGAGTTG -3'
(R):5'- CAGCCTGTCACTGCTGTG -3'
Posted On2017-08-16