Incidental Mutation 'R6031:Olfr199'
ID486301
Institutional Source Beutler Lab
Gene Symbol Olfr199
Ensembl Gene ENSMUSG00000074996
Gene Nameolfactory receptor 199
SynonymsGA_x54KRFPKG5P-55430495-55429569, MOR182-14
MMRRC Submission 044203-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6031 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59214134-59219767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59215933 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 227 (R227G)
Ref Sequence ENSEMBL: ENSMUSP00000150643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099657] [ENSMUST00000214186]
Predicted Effect probably benign
Transcript: ENSMUST00000099657
AA Change: R227G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097249
Gene: ENSMUSG00000074996
AA Change: R227G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.6e-6 PFAM
Pfam:7tm_1 41 290 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214186
AA Change: R227G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,252 Y304H possibly damaging Het
Add2 A G 6: 86,098,673 E268G probably damaging Het
Akr1b3 A C 6: 34,312,674 V67G probably benign Het
Alms1 A T 6: 85,622,955 N1588Y probably damaging Het
Arhgap23 A T 11: 97,476,139 D1082V probably damaging Het
Asb6 A G 2: 30,824,195 V301A probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Atg7 T A 6: 114,671,233 C31S probably benign Het
Camsap2 A T 1: 136,280,438 N1105K possibly damaging Het
Ccdc109b A G 3: 129,926,389 Y152H probably damaging Het
Ccdc125 C T 13: 100,684,369 probably null Het
Ccdc63 T C 5: 122,129,736 I56V possibly damaging Het
Cpd T C 11: 76,790,888 E1143G probably benign Het
Cpt1a T A 19: 3,371,556 probably null Het
Creb3l2 A T 6: 37,334,434 D473E probably benign Het
Disp2 G T 2: 118,789,794 V336L probably benign Het
Efr3b A G 12: 3,967,106 I782T possibly damaging Het
Fam98a A G 17: 75,539,432 V230A probably damaging Het
Fat3 T A 9: 15,988,492 T3082S probably benign Het
Frmd3 T C 4: 74,187,451 Y445H probably damaging Het
Galt G A 4: 41,757,202 R185Q probably benign Het
Gatb T C 3: 85,613,511 I309T possibly damaging Het
Gfi1b G A 2: 28,613,808 Q127* probably null Het
Gfpt1 C A 6: 87,086,320 T563N probably damaging Het
Gria1 A G 11: 57,217,782 D237G probably damaging Het
Hspbp1 A T 7: 4,663,466 V305D probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Iars T C 13: 49,705,831 V9A probably damaging Het
Ipo4 G A 14: 55,632,139 P355S probably damaging Het
Jade2 G T 11: 51,826,586 C314* probably null Het
Kri1 T C 9: 21,275,269 E597G probably benign Het
Med23 C T 10: 24,903,748 R542* probably null Het
Ndc80 T C 17: 71,511,488 N291S probably benign Het
Nop2 T C 6: 125,133,566 probably null Het
Nrxn1 T C 17: 90,588,790 N984S probably damaging Het
Ntm A C 9: 29,009,375 L86R probably damaging Het
Numa1 T A 7: 102,012,012 D1847E possibly damaging Het
Odf2l A G 3: 145,139,863 Q334R probably damaging Het
Olfr1238 T A 2: 89,406,972 T36S probably damaging Het
Olfr1333 A T 4: 118,830,391 probably null Het
Olfr522 A T 7: 140,162,809 V47E possibly damaging Het
Olfr706 C T 7: 106,885,927 V297I possibly damaging Het
Olfr772 A G 10: 129,174,355 V222A probably benign Het
Pcdhb19 A T 18: 37,497,723 K190N probably damaging Het
Pdik1l A G 4: 134,279,041 F197L probably damaging Het
Rnf113a2 T C 12: 84,417,990 F219L probably damaging Het
Rnf208 A C 2: 25,243,764 T157P probably damaging Het
RP23-145I16.3 A T 7: 142,376,714 C364S probably damaging Het
Scn8a A T 15: 100,983,984 D644V probably damaging Het
Thbs3 T A 3: 89,218,094 C204S probably damaging Het
Tlr3 A G 8: 45,398,528 I444T probably damaging Het
Tmem206 A G 1: 191,340,840 R153G probably benign Het
Trpm8 A T 1: 88,354,469 I696F possibly damaging Het
Ttn A T 2: 76,830,597 V7422D possibly damaging Het
Ufl1 A G 4: 25,278,038 V139A probably benign Het
Uggt2 A T 14: 119,070,826 V381D probably benign Het
Vgll3 T A 16: 65,839,481 Y173N probably damaging Het
Vmn1r9 A G 6: 57,071,173 T78A probably benign Het
Vps13b T A 15: 35,471,968 L806M probably damaging Het
Vps13d A C 4: 145,168,509 H394Q probably benign Het
Wdr53 T A 16: 32,256,718 V247D probably damaging Het
Wdr81 A T 11: 75,447,869 L1488Q probably damaging Het
Zc3h6 A G 2: 128,967,812 D3G possibly damaging Het
Zfp93 G T 7: 24,276,300 C570F probably damaging Het
Zfp943 C T 17: 21,993,376 T481I probably benign Het
Other mutations in Olfr199
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr199 APN 16 59216496 missense probably damaging 0.97
IGL00972:Olfr199 APN 16 59216466 missense probably damaging 1.00
IGL01734:Olfr199 APN 16 59216429 missense probably benign 0.12
IGL01876:Olfr199 APN 16 59216019 missense possibly damaging 0.89
IGL02017:Olfr199 APN 16 59215947 missense probably damaging 1.00
IGL02871:Olfr199 APN 16 59216374 nonsense probably null
IGL03153:Olfr199 APN 16 59216203 missense probably benign 0.35
R0702:Olfr199 UTSW 16 59215699 missense probably benign
R0825:Olfr199 UTSW 16 59216450 missense possibly damaging 0.70
R1522:Olfr199 UTSW 16 59215984 missense probably damaging 1.00
R1769:Olfr199 UTSW 16 59215981 missense probably benign 0.01
R2144:Olfr199 UTSW 16 59216026 missense probably benign 0.00
R3956:Olfr199 UTSW 16 59216065 nonsense probably null
R4783:Olfr199 UTSW 16 59215859 missense probably damaging 0.98
R5534:Olfr199 UTSW 16 59216040 missense probably benign 0.39
R6031:Olfr199 UTSW 16 59215933 missense probably benign 0.00
R6141:Olfr199 UTSW 16 59216553 missense probably benign
R6445:Olfr199 UTSW 16 59216109 missense probably damaging 1.00
R6459:Olfr199 UTSW 16 59216020 missense probably benign 0.44
R6568:Olfr199 UTSW 16 59216278 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ACTGTAAACAAATGGGTTGAGC -3'
(R):5'- GCACTTGGCAATTCACGTG -3'

Sequencing Primer
(F):5'- TGGGTTGAGCAAAGGAATTATGACTG -3'
(R):5'- TAGACTGACTTTCTGCAGATCCAAC -3'
Posted On2017-08-16