Incidental Mutation 'R0522:Prmt1'
ID48634
Institutional Source Beutler Lab
Gene Symbol Prmt1
Ensembl Gene ENSMUSG00000109324
Gene Nameprotein arginine N-methyltransferase 1
SynonymsHrmt1l2
MMRRC Submission 038715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R0522 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44975989-44986568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44981779 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 50 (C50S)
Ref Sequence ENSEMBL: ENSMUSP00000045365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045325] [ENSMUST00000107843] [ENSMUST00000207370] [ENSMUST00000207522] [ENSMUST00000207659] [ENSMUST00000208312] [ENSMUST00000208829] [ENSMUST00000208938] [ENSMUST00000209124]
Predicted Effect probably benign
Transcript: ENSMUST00000045325
AA Change: C50S

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045365
Gene: ENSMUSG00000109324
AA Change: C50S

DomainStartEndE-ValueType
Pfam:PRMT5 41 343 3.9e-11 PFAM
Pfam:Met_10 72 184 5.4e-7 PFAM
Pfam:MTS 78 162 7e-7 PFAM
Pfam:PrmA 79 182 8.1e-10 PFAM
Pfam:Methyltransf_31 86 226 4.1e-10 PFAM
Pfam:Methyltransf_18 88 195 3.5e-9 PFAM
Pfam:Methyltransf_26 89 189 1.4e-8 PFAM
Pfam:Methyltransf_11 93 192 3.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107843
AA Change: C103S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103474
Gene: ENSMUSG00000109324
AA Change: C103S

DomainStartEndE-ValueType
Pfam:PRMT5 41 343 1.9e-8 PFAM
Pfam:MTS 78 162 1.1e-6 PFAM
Pfam:PrmA 79 181 1.3e-9 PFAM
Pfam:Methyltransf_31 86 226 4e-10 PFAM
Pfam:Methyltransf_18 88 192 6.2e-9 PFAM
Pfam:Methyltransf_11 93 192 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207370
AA Change: C85S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000207522
Predicted Effect unknown
Transcript: ENSMUST00000207659
AA Change: C85S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207735
Predicted Effect probably benign
Transcript: ENSMUST00000208312
AA Change: C85S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000208778
Predicted Effect probably benign
Transcript: ENSMUST00000208829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208897
Predicted Effect probably benign
Transcript: ENSMUST00000208938
AA Change: C61S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect unknown
Transcript: ENSMUST00000209056
AA Change: C84S
Predicted Effect probably benign
Transcript: ENSMUST00000209124
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein arginine N-methyltransferase (PRMT) family. Post-translational modification of target proteins by PRMTs plays an important regulatory role in many biological processes, whereby PRMTs methylate arginine residues by transferring methyl groups from S-adenosyl-L-methionine to terminal guanidino nitrogen atoms. The encoded protein is a type I PRMT and is responsible for the majority of cellular arginine methylation activity. Increased expression of this gene may play a role in many types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Embryos homozygous for a null mutation die before E6.5 and exhibit abnormal embryonic tissue morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik A C 1: 181,059,747 D299A probably damaging Het
Adgre5 A G 8: 83,730,176 I192T probably benign Het
Adgrl3 T C 5: 81,726,801 Y982H possibly damaging Het
Adgrv1 T A 13: 81,528,442 probably benign Het
Alms1 T C 6: 85,621,615 V1610A probably benign Het
Ankrd24 T C 10: 81,636,355 probably benign Het
C2cd3 A G 7: 100,395,222 N337S probably benign Het
Cdc40 T C 10: 40,857,612 Y114C probably benign Het
Cdhr1 A T 14: 37,094,000 probably null Het
Cfc1 G A 1: 34,537,153 C98Y probably damaging Het
Cyp11b2 A T 15: 74,851,684 probably benign Het
Cyth4 C A 15: 78,615,785 H255Q possibly damaging Het
Dip2a T C 10: 76,321,531 K80R probably benign Het
Dnajb5 G T 4: 42,957,083 D257Y probably damaging Het
Dynll1 T C 5: 115,300,506 probably benign Het
Edn1 T A 13: 42,304,954 V81E probably damaging Het
F5 T C 1: 164,211,763 S1981P probably damaging Het
Fam186b T A 15: 99,280,519 M309L probably benign Het
Gm14221 G A 2: 160,574,677 noncoding transcript Het
Gnptab T A 10: 88,431,466 probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gpr176 A G 2: 118,284,012 C106R probably damaging Het
Hdac7 A T 15: 97,806,679 probably null Het
Hlx T C 1: 184,731,640 S168G probably damaging Het
Hnf1a G T 5: 114,950,688 probably benign Het
Hp1bp3 C T 4: 138,222,161 L19F possibly damaging Het
Hspa14 T A 2: 3,511,049 T63S probably damaging Het
Insrr C T 3: 87,800,872 S207F probably damaging Het
Jak3 C A 8: 71,682,274 probably benign Het
Jmjd7 G A 2: 120,030,341 A91T probably damaging Het
Lgals9 G T 11: 78,965,812 H265Q possibly damaging Het
Lrriq1 T G 10: 103,161,777 N1326H probably damaging Het
Mdn1 C A 4: 32,672,837 Q486K probably benign Het
Mpeg1 A G 19: 12,461,759 T194A probably damaging Het
Nek5 T A 8: 22,088,797 probably benign Het
Pcgf2 A C 11: 97,692,047 I135M probably benign Het
Phactr1 G T 13: 43,059,591 A222S probably benign Het
Pla2r1 T C 2: 60,479,515 S575G probably benign Het
Plcg2 T C 8: 117,614,288 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Polg A G 7: 79,460,151 probably benign Het
Poteg T G 8: 27,449,958 L48V possibly damaging Het
Prx T A 7: 27,518,195 V707E probably damaging Het
Rrp12 C T 19: 41,874,705 probably benign Het
Saxo1 A T 4: 86,445,103 V381E probably damaging Het
Sh2d2a T C 3: 87,847,109 probably null Het
Slc26a5 A C 5: 21,846,345 I57R probably damaging Het
Slc38a3 T A 9: 107,655,213 probably null Het
Slc5a4b T C 10: 76,090,700 T188A probably damaging Het
Slc7a13 A G 4: 19,824,010 I260V probably benign Het
Smg8 A T 11: 87,086,462 S98T probably benign Het
Spg20 T A 3: 55,128,365 S548R probably damaging Het
Sult6b1 C T 17: 78,905,529 G98S probably damaging Het
Tbc1d2 A G 4: 46,649,806 Y77H probably damaging Het
Tet2 T A 3: 133,466,804 D1899V probably damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Uap1l1 T C 2: 25,363,277 E382G probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Ugt1a9 T C 1: 88,071,392 V188A probably damaging Het
Virma T C 4: 11,519,416 probably null Het
Xrcc6 T C 15: 82,022,592 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Zfp804b T A 5: 6,772,014 T350S probably benign Het
Zfp959 G T 17: 55,896,201 R61M probably null Het
Other mutations in Prmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Prmt1 APN 7 44977635 unclassified probably benign
IGL03195:Prmt1 APN 7 44977571 missense probably damaging 0.98
R0110:Prmt1 UTSW 7 44978801 unclassified probably benign
R0313:Prmt1 UTSW 7 44978748 missense probably benign 0.39
R0326:Prmt1 UTSW 7 44979454 missense probably damaging 1.00
R0531:Prmt1 UTSW 7 44977624 missense probably damaging 1.00
R0611:Prmt1 UTSW 7 44978801 splice site probably null
R2002:Prmt1 UTSW 7 44978724 missense probably damaging 1.00
R4712:Prmt1 UTSW 7 44981636 missense probably damaging 1.00
R6032:Prmt1 UTSW 7 44977102 unclassified probably null
R6153:Prmt1 UTSW 7 44981827 missense probably damaging 1.00
R7087:Prmt1 UTSW 7 44981583 splice site probably null
R7216:Prmt1 UTSW 7 44983573 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGAGCACAGTCACCAAAGATCC -3'
(R):5'- GTTCACTGCAAAAGAAGCGCCC -3'

Sequencing Primer
(F):5'- TGAAGGAGCCACCAGTTGTC -3'
(R):5'- TGCTCACCGTCAGTGTG -3'
Posted On2013-06-12