Incidental Mutation 'R0522:C2cd3'
ID48637
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene NameC2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission 038715-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0522 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100372233-100470152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100395222 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 337 (N337S)
Ref Sequence ENSEMBL: ENSMUSP00000095859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000133464]
Predicted Effect probably benign
Transcript: ENSMUST00000051777
AA Change: N337S

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: N337S

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098259
AA Change: N337S

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: N337S

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119647
SMART Domains Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
C2 61 199 2.36e1 SMART
C2 327 436 3.73e0 SMART
C2 526 666 1.47e1 SMART
C2 719 858 1.63e1 SMART
C2 1154 1261 1.43e-2 SMART
low complexity region 1429 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133464
SMART Domains Protein: ENSMUSP00000118864
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208753
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik A C 1: 181,059,747 D299A probably damaging Het
Adgre5 A G 8: 83,730,176 I192T probably benign Het
Adgrl3 T C 5: 81,726,801 Y982H possibly damaging Het
Adgrv1 T A 13: 81,528,442 probably benign Het
Alms1 T C 6: 85,621,615 V1610A probably benign Het
Ankrd24 T C 10: 81,636,355 probably benign Het
Cdc40 T C 10: 40,857,612 Y114C probably benign Het
Cdhr1 A T 14: 37,094,000 probably null Het
Cfc1 G A 1: 34,537,153 C98Y probably damaging Het
Cyp11b2 A T 15: 74,851,684 probably benign Het
Cyth4 C A 15: 78,615,785 H255Q possibly damaging Het
Dip2a T C 10: 76,321,531 K80R probably benign Het
Dnajb5 G T 4: 42,957,083 D257Y probably damaging Het
Dynll1 T C 5: 115,300,506 probably benign Het
Edn1 T A 13: 42,304,954 V81E probably damaging Het
F5 T C 1: 164,211,763 S1981P probably damaging Het
Fam186b T A 15: 99,280,519 M309L probably benign Het
Gm14221 G A 2: 160,574,677 noncoding transcript Het
Gnptab T A 10: 88,431,466 probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gpr176 A G 2: 118,284,012 C106R probably damaging Het
Hdac7 A T 15: 97,806,679 probably null Het
Hlx T C 1: 184,731,640 S168G probably damaging Het
Hnf1a G T 5: 114,950,688 probably benign Het
Hp1bp3 C T 4: 138,222,161 L19F possibly damaging Het
Hspa14 T A 2: 3,511,049 T63S probably damaging Het
Insrr C T 3: 87,800,872 S207F probably damaging Het
Jak3 C A 8: 71,682,274 probably benign Het
Jmjd7 G A 2: 120,030,341 A91T probably damaging Het
Lgals9 G T 11: 78,965,812 H265Q possibly damaging Het
Lrriq1 T G 10: 103,161,777 N1326H probably damaging Het
Mdn1 C A 4: 32,672,837 Q486K probably benign Het
Mpeg1 A G 19: 12,461,759 T194A probably damaging Het
Nek5 T A 8: 22,088,797 probably benign Het
Pcgf2 A C 11: 97,692,047 I135M probably benign Het
Phactr1 G T 13: 43,059,591 A222S probably benign Het
Pla2r1 T C 2: 60,479,515 S575G probably benign Het
Plcg2 T C 8: 117,614,288 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Polg A G 7: 79,460,151 probably benign Het
Poteg T G 8: 27,449,958 L48V possibly damaging Het
Prmt1 A T 7: 44,981,779 C50S probably benign Het
Prx T A 7: 27,518,195 V707E probably damaging Het
Rrp12 C T 19: 41,874,705 probably benign Het
Saxo1 A T 4: 86,445,103 V381E probably damaging Het
Sh2d2a T C 3: 87,847,109 probably null Het
Slc26a5 A C 5: 21,846,345 I57R probably damaging Het
Slc38a3 T A 9: 107,655,213 probably null Het
Slc5a4b T C 10: 76,090,700 T188A probably damaging Het
Slc7a13 A G 4: 19,824,010 I260V probably benign Het
Smg8 A T 11: 87,086,462 S98T probably benign Het
Spg20 T A 3: 55,128,365 S548R probably damaging Het
Sult6b1 C T 17: 78,905,529 G98S probably damaging Het
Tbc1d2 A G 4: 46,649,806 Y77H probably damaging Het
Tet2 T A 3: 133,466,804 D1899V probably damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Uap1l1 T C 2: 25,363,277 E382G probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Ugt1a9 T C 1: 88,071,392 V188A probably damaging Het
Virma T C 4: 11,519,416 probably null Het
Xrcc6 T C 15: 82,022,592 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Zfp804b T A 5: 6,772,014 T350S probably benign Het
Zfp959 G T 17: 55,896,201 R61M probably null Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100391128 missense probably benign 0.14
IGL01420:C2cd3 APN 7 100454858 missense probably benign 0.35
IGL01775:C2cd3 APN 7 100443431 missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100427214 missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100374486 missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100419715 missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100427169 unclassified probably benign
IGL02852:C2cd3 APN 7 100430189 missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100374476 missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0124:C2cd3 UTSW 7 100469518 missense probably benign
R0387:C2cd3 UTSW 7 100422507 splice site probably benign
R1124:C2cd3 UTSW 7 100422681 missense probably benign 0.00
R1484:C2cd3 UTSW 7 100440190 missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100406077 missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100372497 critical splice donor site probably null
R1875:C2cd3 UTSW 7 100407025 missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100455493 unclassified probably benign
R2060:C2cd3 UTSW 7 100454948 missense probably damaging 1.00
R2348:C2cd3 UTSW 7 100413366 missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100395252 missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R3687:C2cd3 UTSW 7 100435833 missense probably benign 0.28
R3775:C2cd3 UTSW 7 100431998 missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100454601 critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100441089 missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100432099 missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100374477 missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100372450 unclassified probably benign
R4705:C2cd3 UTSW 7 100395188 missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100443435 missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100416332 missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100391019 missense probably benign 0.01
R4842:C2cd3 UTSW 7 100416190 missense probably benign 0.00
R4858:C2cd3 UTSW 7 100454953 missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100413374 missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100405959 missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100459842 missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100443485 missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R5538:C2cd3 UTSW 7 100455493 critical splice donor site probably null
R5861:C2cd3 UTSW 7 100444475 unclassified probably benign
R6110:C2cd3 UTSW 7 100441076 missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100416428 missense probably benign 0.02
R6429:C2cd3 UTSW 7 100432091 missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100455298 missense probably benign
R6613:C2cd3 UTSW 7 100395241 missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100418540 missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100455346 missense probably benign
R6837:C2cd3 UTSW 7 100448746 missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100406927 missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100390241 missense probably benign 0.28
R6929:C2cd3 UTSW 7 100451619 missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100432092 missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100416181 missense
R7174:C2cd3 UTSW 7 100432198 missense
R7241:C2cd3 UTSW 7 100407050 missense
X0002:C2cd3 UTSW 7 100440235 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCGTTGTTAAGCGAACATCCTCAAG -3'
(R):5'- AGCCTTCTACTGTAGGCTCAGCAC -3'

Sequencing Primer
(F):5'- TCCTCAAGGAATTGCCAGACTAATG -3'
(R):5'- TGTAGGCTCAGCACACTAAG -3'
Posted On2013-06-12