Incidental Mutation 'R6034:Kcnip4'
ID486433
Institutional Source Beutler Lab
Gene Symbol Kcnip4
Ensembl Gene ENSMUSG00000029088
Gene NameKv channel interacting protein 4
SynonymsKChIP4a, Calp250
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R6034 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location48389502-49524907 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 48390941 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 241 (R241S)
Ref Sequence ENSEMBL: ENSMUSP00000084656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030968] [ENSMUST00000087395] [ENSMUST00000166924] [ENSMUST00000175660] [ENSMUST00000176191] [ENSMUST00000176978] [ENSMUST00000196950] [ENSMUST00000200566]
PDB Structure
Structural Basis of KChIP4a Modulation of Kv4.3 Slow Inactivation [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030968
SMART Domains Protein: ENSMUSP00000030968
Gene: ENSMUSG00000029089

DomainStartEndE-ValueType
low complexity region 46 59 N/A INTRINSIC
Pfam:ParcG 78 245 1e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000087395
AA Change: R241S

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084656
Gene: ENSMUSG00000029088
AA Change: R241S

DomainStartEndE-ValueType
EFh 124 152 6.16e-2 SMART
EFh 160 188 8.9e-8 SMART
EFh 208 236 6.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101215
SMART Domains Protein: ENSMUSP00000098776
Gene: ENSMUSG00000029088

DomainStartEndE-ValueType
EFh 62 90 6.16e-2 SMART
EFh 98 126 8.9e-8 SMART
EFh 146 174 6.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166924
AA Change: R224S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131276
Gene: ENSMUSG00000029088
AA Change: R224S

DomainStartEndE-ValueType
EFh 107 135 6.16e-2 SMART
EFh 143 171 8.9e-8 SMART
EFh 191 219 6.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172363
SMART Domains Protein: ENSMUSP00000127538
Gene: ENSMUSG00000029088

DomainStartEndE-ValueType
EFh 90 118 6.16e-2 SMART
EFh 126 154 8.9e-8 SMART
EFh 174 202 6.14e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000175660
AA Change: R216S

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135799
Gene: ENSMUSG00000029088
AA Change: R216S

DomainStartEndE-ValueType
EFh 99 127 6.16e-2 SMART
EFh 135 163 8.9e-8 SMART
EFh 183 211 6.14e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176191
AA Change: R207S

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135071
Gene: ENSMUSG00000029088
AA Change: R207S

DomainStartEndE-ValueType
EFh 62 90 6.16e-2 SMART
EFh 98 126 8.9e-8 SMART
EFh 146 174 6.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176521
Predicted Effect probably benign
Transcript: ENSMUST00000176978
AA Change: R220S

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134758
Gene: ENSMUSG00000029088
AA Change: R220S

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
EFh 103 131 6.16e-2 SMART
EFh 139 167 8.9e-8 SMART
EFh 187 215 6.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195960
Predicted Effect probably benign
Transcript: ENSMUST00000196950
SMART Domains Protein: ENSMUSP00000143072
Gene: ENSMUSG00000029089

DomainStartEndE-ValueType
low complexity region 46 59 N/A INTRINSIC
Pfam:ParcG 78 245 1e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197915
Predicted Effect probably benign
Transcript: ENSMUST00000200566
SMART Domains Protein: ENSMUSP00000142613
Gene: ENSMUSG00000029089

DomainStartEndE-ValueType
low complexity region 46 59 N/A INTRINSIC
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. This protein member also interacts with presenilin. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
Gapdh T C 6: 125,165,298 D25G probably benign Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Kcnip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Kcnip4 APN 5 48409785 splice site probably benign
IGL03386:Kcnip4 APN 5 48482547 missense probably damaging 1.00
R0453:Kcnip4 UTSW 5 48509712 missense probably damaging 0.96
R0811:Kcnip4 UTSW 5 48409860 missense probably benign 0.00
R0812:Kcnip4 UTSW 5 48409860 missense probably benign 0.00
R0856:Kcnip4 UTSW 5 48419210 critical splice donor site probably null
R4879:Kcnip4 UTSW 5 48409865 missense possibly damaging 0.95
R6034:Kcnip4 UTSW 5 48390941 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACATGGATGCAGATTTGTAACTGG -3'
(R):5'- CAACCTTGGTCTAGCTAGTACC -3'

Sequencing Primer
(F):5'- TGGATGCAGATTTGTAACTGGAAAAC -3'
(R):5'- CCTTGGTCTAGCTAGTACCAAATAAG -3'
Posted On2017-08-16