Incidental Mutation 'R0522:Hdac7'
ID48659
Institutional Source Beutler Lab
Gene Symbol Hdac7
Ensembl Gene ENSMUSG00000022475
Gene Namehistone deacetylase 7
SynonymsHdac7a, 5830434K02Rik
MMRRC Submission 038715-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0522 (G1)
Quality Score189
Status Validated
Chromosome15
Chromosomal Location97792664-97844502 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 97806679 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000079838] [ENSMUST00000088402] [ENSMUST00000116408] [ENSMUST00000116409] [ENSMUST00000118294] [ENSMUST00000119670] [ENSMUST00000120683] [ENSMUST00000121514] [ENSMUST00000156045]
Predicted Effect probably null
Transcript: ENSMUST00000079838
SMART Domains Protein: ENSMUSP00000078766
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
low complexity region 357 375 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 485 498 N/A INTRINSIC
Pfam:Hist_deacetyl 523 853 2.5e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000088402
SMART Domains Protein: ENSMUSP00000085744
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 220 235 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
low complexity region 479 492 N/A INTRINSIC
Pfam:Hist_deacetyl 517 847 2.5e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116408
SMART Domains Protein: ENSMUSP00000112109
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
Pfam:Hist_deacetyl 495 825 2.3e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116409
SMART Domains Protein: ENSMUSP00000112110
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 359 377 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Pfam:Hist_deacetyl 532 862 9.1e-83 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118294
SMART Domains Protein: ENSMUSP00000113380
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 359 377 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
Pfam:Hist_deacetyl 525 855 2.6e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119670
SMART Domains Protein: ENSMUSP00000112459
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 174 189 N/A INTRINSIC
low complexity region 298 316 N/A INTRINSIC
low complexity region 374 386 N/A INTRINSIC
low complexity region 390 402 N/A INTRINSIC
low complexity region 433 446 N/A INTRINSIC
Pfam:Hist_deacetyl 471 801 2.3e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120683
SMART Domains Protein: ENSMUSP00000112446
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
Pfam:Hist_deacetyl 495 623 7.9e-9 PFAM
Pfam:Hist_deacetyl 623 777 3.5e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121514
SMART Domains Protein: ENSMUSP00000112641
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 392 405 N/A INTRINSIC
Pfam:Hist_deacetyl 430 760 9e-92 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134258
SMART Domains Protein: ENSMUSP00000118599
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 52 64 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 111 124 N/A INTRINSIC
PDB:3ZNS|C 127 241 5e-70 PDB
SCOP:d1c3pa_ 139 219 2e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135651
SMART Domains Protein: ENSMUSP00000119970
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
Pfam:Hist_deacetyl 166 213 8.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156045
SMART Domains Protein: ENSMUSP00000120576
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 220 235 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
low complexity region 479 492 N/A INTRINSIC
PDB:3ZNS|C 495 602 2e-60 PDB
SCOP:d1c3pa_ 507 587 6e-16 SMART
low complexity region 603 621 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228466
Meta Mutation Damage Score 0.6684 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to mouse HDAC7 gene whose protein promotes repression mediated via the transcriptional corepressor SMRT. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion of this gene result in embryonic lethality by E11, due to vascular defects which are due to endothelial cell adhesion defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik A C 1: 181,059,747 D299A probably damaging Het
Adgre5 A G 8: 83,730,176 I192T probably benign Het
Adgrl3 T C 5: 81,726,801 Y982H possibly damaging Het
Adgrv1 T A 13: 81,528,442 probably benign Het
Alms1 T C 6: 85,621,615 V1610A probably benign Het
Ankrd24 T C 10: 81,636,355 probably benign Het
C2cd3 A G 7: 100,395,222 N337S probably benign Het
Cdc40 T C 10: 40,857,612 Y114C probably benign Het
Cdhr1 A T 14: 37,094,000 probably null Het
Cfc1 G A 1: 34,537,153 C98Y probably damaging Het
Cyp11b2 A T 15: 74,851,684 probably benign Het
Cyth4 C A 15: 78,615,785 H255Q possibly damaging Het
Dip2a T C 10: 76,321,531 K80R probably benign Het
Dnajb5 G T 4: 42,957,083 D257Y probably damaging Het
Dynll1 T C 5: 115,300,506 probably benign Het
Edn1 T A 13: 42,304,954 V81E probably damaging Het
F5 T C 1: 164,211,763 S1981P probably damaging Het
Fam186b T A 15: 99,280,519 M309L probably benign Het
Gm14221 G A 2: 160,574,677 noncoding transcript Het
Gnptab T A 10: 88,431,466 probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gpr176 A G 2: 118,284,012 C106R probably damaging Het
Hlx T C 1: 184,731,640 S168G probably damaging Het
Hnf1a G T 5: 114,950,688 probably benign Het
Hp1bp3 C T 4: 138,222,161 L19F possibly damaging Het
Hspa14 T A 2: 3,511,049 T63S probably damaging Het
Insrr C T 3: 87,800,872 S207F probably damaging Het
Jak3 C A 8: 71,682,274 probably benign Het
Jmjd7 G A 2: 120,030,341 A91T probably damaging Het
Lgals9 G T 11: 78,965,812 H265Q possibly damaging Het
Lrriq1 T G 10: 103,161,777 N1326H probably damaging Het
Mdn1 C A 4: 32,672,837 Q486K probably benign Het
Mpeg1 A G 19: 12,461,759 T194A probably damaging Het
Nek5 T A 8: 22,088,797 probably benign Het
Pcgf2 A C 11: 97,692,047 I135M probably benign Het
Phactr1 G T 13: 43,059,591 A222S probably benign Het
Pla2r1 T C 2: 60,479,515 S575G probably benign Het
Plcg2 T C 8: 117,614,288 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Polg A G 7: 79,460,151 probably benign Het
Poteg T G 8: 27,449,958 L48V possibly damaging Het
Prmt1 A T 7: 44,981,779 C50S probably benign Het
Prx T A 7: 27,518,195 V707E probably damaging Het
Rrp12 C T 19: 41,874,705 probably benign Het
Saxo1 A T 4: 86,445,103 V381E probably damaging Het
Sh2d2a T C 3: 87,847,109 probably null Het
Slc26a5 A C 5: 21,846,345 I57R probably damaging Het
Slc38a3 T A 9: 107,655,213 probably null Het
Slc5a4b T C 10: 76,090,700 T188A probably damaging Het
Slc7a13 A G 4: 19,824,010 I260V probably benign Het
Smg8 A T 11: 87,086,462 S98T probably benign Het
Spg20 T A 3: 55,128,365 S548R probably damaging Het
Sult6b1 C T 17: 78,905,529 G98S probably damaging Het
Tbc1d2 A G 4: 46,649,806 Y77H probably damaging Het
Tet2 T A 3: 133,466,804 D1899V probably damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Uap1l1 T C 2: 25,363,277 E382G probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Ugt1a9 T C 1: 88,071,392 V188A probably damaging Het
Virma T C 4: 11,519,416 probably null Het
Xrcc6 T C 15: 82,022,592 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Zfp804b T A 5: 6,772,014 T350S probably benign Het
Zfp959 G T 17: 55,896,201 R61M probably null Het
Other mutations in Hdac7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Hdac7 APN 15 97809495 missense probably damaging 0.98
IGL01011:Hdac7 APN 15 97793935 missense possibly damaging 0.83
IGL01361:Hdac7 APN 15 97811442 missense possibly damaging 0.85
IGL01474:Hdac7 APN 15 97797939 critical splice donor site probably null
IGL02314:Hdac7 APN 15 97809004 missense probably damaging 1.00
IGL02379:Hdac7 APN 15 97808385 missense probably damaging 0.99
IGL02665:Hdac7 APN 15 97796957 unclassified probably benign
IGL03010:Hdac7 APN 15 97793929 critical splice donor site probably null
IGL03023:Hdac7 APN 15 97797957 missense probably damaging 1.00
IGL03081:Hdac7 APN 15 97798306 missense probably damaging 1.00
Cairn UTSW 15 97808495 frame shift probably null
Signpost UTSW 15 97802747 missense probably damaging 1.00
R0285:Hdac7 UTSW 15 97798222 critical splice donor site probably null
R0518:Hdac7 UTSW 15 97806499 nonsense probably null
R0521:Hdac7 UTSW 15 97806499 nonsense probably null
R1543:Hdac7 UTSW 15 97809529 splice site probably benign
R1623:Hdac7 UTSW 15 97808404 nonsense probably null
R1665:Hdac7 UTSW 15 97806525 missense probably damaging 1.00
R1844:Hdac7 UTSW 15 97807976 missense probably damaging 0.98
R1895:Hdac7 UTSW 15 97796886 missense probably damaging 1.00
R1975:Hdac7 UTSW 15 97806505 nonsense probably null
R1976:Hdac7 UTSW 15 97806505 nonsense probably null
R2038:Hdac7 UTSW 15 97798270 missense probably damaging 1.00
R2155:Hdac7 UTSW 15 97794063 missense probably benign 0.00
R2156:Hdac7 UTSW 15 97794063 missense probably benign 0.00
R2263:Hdac7 UTSW 15 97810851 critical splice donor site probably null
R3546:Hdac7 UTSW 15 97808009 missense probably damaging 1.00
R4438:Hdac7 UTSW 15 97807715 missense probably damaging 1.00
R4642:Hdac7 UTSW 15 97806516 missense probably damaging 1.00
R4704:Hdac7 UTSW 15 97796216 missense probably damaging 1.00
R4705:Hdac7 UTSW 15 97811587 missense probably damaging 0.99
R5303:Hdac7 UTSW 15 97798018 missense probably damaging 0.97
R5577:Hdac7 UTSW 15 97811455 missense probably benign 0.09
R5966:Hdac7 UTSW 15 97802491 missense probably damaging 1.00
R5974:Hdac7 UTSW 15 97802072 splice site probably null
R6270:Hdac7 UTSW 15 97808495 frame shift probably null
R6384:Hdac7 UTSW 15 97811506 nonsense probably null
R6835:Hdac7 UTSW 15 97802747 missense probably damaging 1.00
R6869:Hdac7 UTSW 15 97796176 missense probably damaging 1.00
X0028:Hdac7 UTSW 15 97809008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACCTCTGGAACTGTCCGAAAG -3'
(R):5'- AGGCAGTCGCTTGTGCTTAGTATC -3'

Sequencing Primer
(F):5'- ACTGTCCGAAAGGCAGTGC -3'
(R):5'- CAGTTCTATGAGAGGTGATCTCAGAC -3'
Posted On2013-06-12