Incidental Mutation 'R6037:Abi2'
ID486609
Institutional Source Beutler Lab
Gene Symbol Abi2
Ensembl Gene ENSMUSG00000026782
Gene Nameabl-interactor 2
Synonyms8430425M24Rik
MMRRC Submission 043258-MU
Accession Numbers

Genbank: NM_001198570.1, NM_001198571.1, NM_198127.2; Ensembl: ENSMUST00000052332, ENSMUST00000087417

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location60409619-60481158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60464579 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 212 (P212T)
Ref Sequence ENSEMBL: ENSMUSP00000139743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052332] [ENSMUST00000185788] [ENSMUST00000186097] [ENSMUST00000187709] [ENSMUST00000188594] [ENSMUST00000188618] [ENSMUST00000189980] [ENSMUST00000190158]
Predicted Effect probably benign
Transcript: ENSMUST00000052332
SMART Domains Protein: ENSMUSP00000058754
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 168 1.1e-37 PFAM
low complexity region 236 262 N/A INTRINSIC
low complexity region 335 370 N/A INTRINSIC
SH3 387 442 5.55e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185788
SMART Domains Protein: ENSMUSP00000139483
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 67 4.4e-25 PFAM
low complexity region 68 81 N/A INTRINSIC
low complexity region 83 115 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 249 284 N/A INTRINSIC
SH3 301 356 3.4e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186097
AA Change: P268T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139501
Gene: ENSMUSG00000026782
AA Change: P268T

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 95 121 N/A INTRINSIC
low complexity region 125 143 N/A INTRINSIC
low complexity region 284 319 N/A INTRINSIC
SH3 336 391 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187400
Predicted Effect probably damaging
Transcript: ENSMUST00000187709
AA Change: P348T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139867
Gene: ENSMUSG00000026782
AA Change: P348T

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 165 1.8e-33 PFAM
low complexity region 166 179 N/A INTRINSIC
low complexity region 236 262 N/A INTRINSIC
low complexity region 364 399 N/A INTRINSIC
SH3 416 471 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188594
SMART Domains Protein: ENSMUSP00000140750
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 165 1.7e-33 PFAM
low complexity region 166 179 N/A INTRINSIC
low complexity region 181 213 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 347 382 N/A INTRINSIC
SH3 399 454 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188618
SMART Domains Protein: ENSMUSP00000140274
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 5.1e-37 PFAM
low complexity region 172 185 N/A INTRINSIC
low complexity region 242 268 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
low complexity region 402 437 N/A INTRINSIC
SH3 454 487 2.29e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189980
SMART Domains Protein: ENSMUSP00000141068
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 5e-37 PFAM
low complexity region 172 185 N/A INTRINSIC
low complexity region 242 268 N/A INTRINSIC
low complexity region 369 404 N/A INTRINSIC
SH3 421 476 5.55e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190158
AA Change: P212T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139743
Gene: ENSMUSG00000026782
AA Change: P212T

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
PDB:4N78|F 88 196 5e-62 PDB
low complexity region 226 261 N/A INTRINSIC
SH3 278 333 3.4e-26 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display microphthalmia, abnormal lens development, abnormal corpus callosum, cerebral cortex, and hippocampus morphology, and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Abi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Abi2 APN 1 60447346 missense probably damaging 1.00
IGL01369:Abi2 APN 1 60437056 missense probably damaging 1.00
IGL02028:Abi2 APN 1 60434283 missense probably damaging 1.00
IGL02074:Abi2 APN 1 60447307 missense probably damaging 1.00
IGL02897:Abi2 APN 1 60448194 missense probably damaging 0.96
IGL02957:Abi2 APN 1 60470786 missense probably damaging 1.00
1mM(1):Abi2 UTSW 1 60437057 missense probably damaging 1.00
P0026:Abi2 UTSW 1 60453723 missense probably benign 0.42
R0062:Abi2 UTSW 1 60453725 missense probably benign 0.42
R0062:Abi2 UTSW 1 60453725 missense probably benign 0.42
R3946:Abi2 UTSW 1 60453754 missense probably damaging 1.00
R4793:Abi2 UTSW 1 60409804 start codon destroyed probably null 1.00
R5110:Abi2 UTSW 1 60450121 missense probably benign 0.00
R5557:Abi2 UTSW 1 60438912 unclassified probably benign
R6037:Abi2 UTSW 1 60464579 missense probably damaging 1.00
R6368:Abi2 UTSW 1 60453651 missense possibly damaging 0.82
R6481:Abi2 UTSW 1 60438939 unclassified probably null
R7393:Abi2 UTSW 1 60434382 missense possibly damaging 0.92
R7460:Abi2 UTSW 1 60434307 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCAAAAGTGGATCCGAAAG -3'
(R):5'- ATGAGAGTGTCAGTGTCTGAAG -3'

Sequencing Primer
(F):5'- GTGGTGTACCTCCTTACA -3'
(R):5'- TGAAGTCCAGGTCCTCTACTAGAG -3'
Posted On2017-08-16