Incidental Mutation 'R6037:Mki67'
ID486633
Institutional Source Beutler Lab
Gene Symbol Mki67
Ensembl Gene ENSMUSG00000031004
Gene Nameantigen identified by monoclonal antibody Ki 67
SynonymsD630048A14Rik, Ki-67, Ki67
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location135689784-135716361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 135696803 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 2167 (S2167R)
Ref Sequence ENSEMBL: ENSMUSP00000033310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033310]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033310
AA Change: S2167R

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: S2167R

DomainStartEndE-ValueType
FHA 26 76 1.03e-11 SMART
Pfam:PP1_bind 462 519 2.8e-20 PFAM
low complexity region 535 545 N/A INTRINSIC
low complexity region 869 882 N/A INTRINSIC
Pfam:K167R 889 982 1.5e-9 PFAM
K167R 993 1102 2.01e-39 SMART
K167R 1107 1217 1.87e-57 SMART
K167R 1228 1337 1.33e-53 SMART
K167R 1348 1451 6.57e-44 SMART
K167R 1462 1570 9.09e-38 SMART
K167R 1580 1686 5.02e-40 SMART
K167R 1697 1807 9.6e-37 SMART
K167R 1818 1926 5.94e-51 SMART
K167R 1937 2047 1.6e-56 SMART
K167R 2058 2164 4.04e-53 SMART
K167R 2175 2285 1.52e-57 SMART
K167R 2296 2407 1.78e-40 SMART
K167R 2418 2527 1.71e-42 SMART
K167R 2538 2640 7.41e-20 SMART
K167R 2642 2750 1.06e-38 SMART
K167R 2761 2872 2.1e-42 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Mki67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Mki67 APN 7 135690120 missense probably benign 0.32
IGL00264:Mki67 APN 7 135707820 nonsense probably null
IGL00328:Mki67 APN 7 135696695 missense probably benign 0.03
IGL00570:Mki67 APN 7 135708101 missense possibly damaging 0.88
IGL00584:Mki67 APN 7 135695695 missense probably damaging 1.00
IGL00756:Mki67 APN 7 135698731 missense possibly damaging 0.76
IGL01063:Mki67 APN 7 135694922 missense possibly damaging 0.93
IGL01112:Mki67 APN 7 135714016 missense probably damaging 1.00
IGL01360:Mki67 APN 7 135705776 missense probably damaging 1.00
IGL01457:Mki67 APN 7 135699546 missense probably benign 0.00
IGL01686:Mki67 APN 7 135707813 missense probably benign 0.00
IGL01731:Mki67 APN 7 135696549 missense probably benign 0.03
IGL01775:Mki67 APN 7 135698276 missense possibly damaging 0.71
IGL01806:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01860:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01938:Mki67 APN 7 135694330 missense probably benign 0.04
IGL02249:Mki67 APN 7 135700522 missense possibly damaging 0.47
IGL02260:Mki67 APN 7 135701968 missense probably benign 0.00
IGL02270:Mki67 APN 7 135698632 missense probably damaging 1.00
IGL02406:Mki67 APN 7 135698793 missense probably benign 0.00
IGL02499:Mki67 APN 7 135694327 missense possibly damaging 0.94
IGL02655:Mki67 APN 7 135714019 missense probably damaging 0.98
IGL02700:Mki67 APN 7 135708202 missense probably benign 0.02
IGL03370:Mki67 APN 7 135695490 missense probably benign 0.00
PIT4468001:Mki67 UTSW 7 135699147 missense probably benign 0.00
R0001:Mki67 UTSW 7 135699172 missense probably damaging 1.00
R0001:Mki67 UTSW 7 135701019 missense probably damaging 0.99
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0102:Mki67 UTSW 7 135713803 missense probably benign 0.16
R0130:Mki67 UTSW 7 135696459 missense probably damaging 1.00
R0149:Mki67 UTSW 7 135698424 missense probably benign 0.00
R0356:Mki67 UTSW 7 135704406 missense probably benign 0.34
R0482:Mki67 UTSW 7 135699429 missense possibly damaging 0.60
R0508:Mki67 UTSW 7 135700346 missense probably benign
R0532:Mki67 UTSW 7 135698164 nonsense probably null
R0548:Mki67 UTSW 7 135695256 missense probably damaging 1.00
R0548:Mki67 UTSW 7 135696908 missense possibly damaging 0.82
R0557:Mki67 UTSW 7 135699261 missense possibly damaging 0.48
R0627:Mki67 UTSW 7 135708258 missense probably benign 0.31
R0631:Mki67 UTSW 7 135704388 missense probably damaging 0.98
R0848:Mki67 UTSW 7 135701043 missense probably benign 0.21
R1075:Mki67 UTSW 7 135697311 missense probably benign 0.03
R1105:Mki67 UTSW 7 135701050 missense probably benign 0.09
R1272:Mki67 UTSW 7 135700414 nonsense probably null
R1331:Mki67 UTSW 7 135698276 missense possibly damaging 0.71
R1486:Mki67 UTSW 7 135699720 missense probably benign 0.00
R1510:Mki67 UTSW 7 135696171 missense probably benign 0.26
R1573:Mki67 UTSW 7 135695116 missense possibly damaging 0.93
R1586:Mki67 UTSW 7 135713972 nonsense probably null
R1599:Mki67 UTSW 7 135699934 missense probably benign 0.34
R1623:Mki67 UTSW 7 135708818 splice site probably null
R1706:Mki67 UTSW 7 135700566 missense probably benign 0.37
R1718:Mki67 UTSW 7 135695494 missense probably damaging 1.00
R1785:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R1816:Mki67 UTSW 7 135707387 missense possibly damaging 0.68
R1862:Mki67 UTSW 7 135699361 missense probably benign 0.09
R1929:Mki67 UTSW 7 135698065 missense possibly damaging 0.46
R1957:Mki67 UTSW 7 135698399 missense probably benign 0.01
R1971:Mki67 UTSW 7 135713959 critical splice donor site probably null
R1998:Mki67 UTSW 7 135705770 missense probably benign 0.00
R2004:Mki67 UTSW 7 135698509 nonsense probably null
R2005:Mki67 UTSW 7 135698509 nonsense probably null
R2006:Mki67 UTSW 7 135698509 nonsense probably null
R2109:Mki67 UTSW 7 135697863 missense probably damaging 1.00
R2130:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2131:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2133:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2140:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2141:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2142:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2284:Mki67 UTSW 7 135699945 missense probably damaging 0.99
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2913:Mki67 UTSW 7 135700686 missense possibly damaging 0.71
R3404:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3405:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3406:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3777:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3778:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3787:Mki67 UTSW 7 135700283 missense possibly damaging 0.93
R3847:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3848:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3853:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3971:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3972:Mki67 UTSW 7 135696130 missense probably benign 0.10
R4258:Mki67 UTSW 7 135695288 missense possibly damaging 0.86
R4343:Mki67 UTSW 7 135695118 missense probably benign 0.10
R4488:Mki67 UTSW 7 135697671 missense probably benign 0.01
R4528:Mki67 UTSW 7 135695359 missense probably damaging 1.00
R4713:Mki67 UTSW 7 135695469 missense probably benign 0.35
R4867:Mki67 UTSW 7 135699856 missense probably damaging 0.97
R4874:Mki67 UTSW 7 135708771 missense probably damaging 0.97
R4897:Mki67 UTSW 7 135696745 missense probably damaging 1.00
R5045:Mki67 UTSW 7 135707904 missense possibly damaging 0.84
R5306:Mki67 UTSW 7 135714001 missense probably damaging 1.00
R5309:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5312:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5379:Mki67 UTSW 7 135697461 missense possibly damaging 0.95
R5506:Mki67 UTSW 7 135699981 missense possibly damaging 0.60
R5513:Mki67 UTSW 7 135707750 missense probably damaging 0.98
R5742:Mki67 UTSW 7 135704373 missense probably benign 0.20
R5806:Mki67 UTSW 7 135704605 missense probably damaging 1.00
R6008:Mki67 UTSW 7 135697429 missense probably damaging 1.00
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6221:Mki67 UTSW 7 135697914 missense probably benign 0.18
R6294:Mki67 UTSW 7 135704590 missense probably benign 0.09
R6377:Mki67 UTSW 7 135696321 missense possibly damaging 0.67
R6456:Mki67 UTSW 7 135699475 missense possibly damaging 0.59
R6608:Mki67 UTSW 7 135698361 missense probably benign 0.01
R6609:Mki67 UTSW 7 135699829 missense possibly damaging 0.94
R6648:Mki67 UTSW 7 135697440 missense probably damaging 1.00
R6901:Mki67 UTSW 7 135708760 splice site probably null
R6978:Mki67 UTSW 7 135701962 missense probably benign 0.10
R6985:Mki67 UTSW 7 135713865 missense probably damaging 1.00
R7076:Mki67 UTSW 7 135705629 missense probably damaging 0.98
R7217:Mki67 UTSW 7 135704182 missense probably damaging 1.00
R7239:Mki67 UTSW 7 135700176 missense possibly damaging 0.91
R7250:Mki67 UTSW 7 135699324 missense possibly damaging 0.90
R7313:Mki67 UTSW 7 135694671 missense probably benign 0.29
X0020:Mki67 UTSW 7 135714001 missense probably damaging 0.96
X0065:Mki67 UTSW 7 135713844 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCATGAAGGCTGTGCTGTC -3'
(R):5'- TGGATGTGAGAGAAGACCCTTC -3'

Sequencing Primer
(F):5'- CATGAAGGCTGTGCTGTCATTTTC -3'
(R):5'- GTGAGAGAAGACCCTTCAATACTTG -3'
Posted On2017-08-16