Incidental Mutation 'R6038:Steap3'
ID486657
Institutional Source Beutler Lab
Gene Symbol Steap3
Ensembl Gene ENSMUSG00000026389
Gene NameSTEAP family member 3
SynonymspHyde, 1010001D01Rik
MMRRC Submission 044208-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6038 (G1)
Quality Score176.009
Status Validated
Chromosome1
Chromosomal Location120190757-120272705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120241641 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 271 (Y271H)
Ref Sequence ENSEMBL: ENSMUSP00000121046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112639] [ENSMUST00000112640] [ENSMUST00000112641] [ENSMUST00000112643] [ENSMUST00000140490]
Predicted Effect probably damaging
Transcript: ENSMUST00000112639
AA Change: Y271H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108258
Gene: ENSMUSG00000026389
AA Change: Y271H

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112640
AA Change: Y271H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108259
Gene: ENSMUSG00000026389
AA Change: Y271H

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112641
AA Change: Y271H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108260
Gene: ENSMUSG00000026389
AA Change: Y271H

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112643
AA Change: Y309H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108262
Gene: ENSMUSG00000026389
AA Change: Y309H

DomainStartEndE-ValueType
Pfam:F420_oxidored 68 155 7.3e-19 PFAM
Pfam:Ferric_reduct 297 445 7.9e-15 PFAM
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140490
AA Change: Y271H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121046
Gene: ENSMUSG00000026389
AA Change: Y271H

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 1.6e-18 PFAM
Pfam:Ferric_reduct 259 406 3.6e-20 PFAM
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass membrane protein that functions as an iron transporter. The encoded protein can reduce both iron (Fe3+) and copper (Cu2+) cations. This protein may mediate downstream responses to p53, including promoting apoptosis. Deficiency in this gene can cause anemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous inactivation of this gene results in microcytic anemia, increased erythrocyte cell number, abnormal reticulocyte morphology, anisopoikilocytosis, decreased mean corpuscular hemoglobin, decreased mean corpuscular volume, and thrombocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,304,360 C1327R probably damaging Het
Adcy7 A G 8: 88,322,980 T704A probably benign Het
Adgra3 A T 5: 49,999,145 Y414* probably null Het
Adgrf1 T C 17: 43,295,209 S75P probably benign Het
Akirin1 A G 4: 123,750,163 M1T probably null Het
Antxr1 C A 6: 87,287,000 probably null Het
Arid1b A T 17: 5,336,682 Y1470F probably benign Het
Baiap3 T C 17: 25,246,334 D649G probably damaging Het
BC067074 G A 13: 113,318,619 V400M possibly damaging Het
Cabin1 A G 10: 75,739,366 V615A probably benign Het
Cntnap1 G A 11: 101,184,636 R880Q probably benign Het
Col28a1 T C 6: 8,013,140 T971A probably benign Het
Coro7 A T 16: 4,679,550 probably null Het
Defb19 T G 2: 152,576,267 probably null Het
Dnah17 T C 11: 118,055,889 D3045G probably benign Het
Dock4 A T 12: 40,733,351 probably null Het
Egln3 A G 12: 54,181,690 V210A probably damaging Het
Epb41l4a T C 18: 33,854,335 S330G probably benign Het
Epha7 G A 4: 28,821,521 E229K probably damaging Het
Fam71a C T 1: 191,162,722 E575K probably damaging Het
Fam71e1 C T 7: 44,500,295 R147W probably damaging Het
Fam71e2 T C 7: 4,753,595 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Gm29587 G A 12: 74,222,535 probably null Het
Gxylt2 T A 6: 100,804,594 L410Q probably damaging Het
H2-M10.3 C A 17: 36,368,395 C6F probably benign Het
Hecw1 G T 13: 14,346,062 Q197K probably benign Het
Hk3 T C 13: 55,006,560 M778V probably benign Het
Hydin A G 8: 110,599,031 T4691A probably benign Het
Larp1 A G 11: 58,041,605 E204G possibly damaging Het
Lrp12 A C 15: 39,872,380 W738G probably damaging Het
Mdga2 A T 12: 66,630,053 D488E probably damaging Het
Mrc1 G C 2: 14,257,071 W290C probably damaging Het
Nhp2 T C 11: 51,620,085 V55A probably benign Het
Nrm T C 17: 35,861,505 S41P possibly damaging Het
Olfr1116 T A 2: 87,269,267 I141N possibly damaging Het
Olfr58 A G 9: 19,783,562 Y143C probably benign Het
Olfr741 T C 14: 50,486,220 L254P probably damaging Het
Osbpl7 C T 11: 97,050,716 P22S probably benign Het
Pebp1 A T 5: 117,284,105 L124Q probably benign Het
Pfkp G T 13: 6,597,969 H524N probably benign Het
Pnmt G A 11: 98,387,768 D187N probably damaging Het
Ppl A T 16: 5,102,581 I355K possibly damaging Het
Prom1 A T 5: 44,001,793 Y836N probably damaging Het
Rubcnl T C 14: 75,031,970 S23P probably benign Het
Sap130 T A 18: 31,680,486 I532N probably damaging Het
Serpina1e A T 12: 103,946,836 probably null Het
Skiv2l2 A T 13: 112,891,290 S679T probably benign Het
Slc12a3 T G 8: 94,330,472 S124R probably benign Het
Slc24a5 A G 2: 125,085,731 T317A probably benign Het
Smarcad1 T C 6: 65,073,248 S284P possibly damaging Het
Spag9 C G 11: 94,112,092 R724G probably damaging Het
Speg T C 1: 75,418,459 probably null Het
Syne2 C T 12: 75,878,384 Q44* probably null Het
Tas2r114 A T 6: 131,689,481 C195S possibly damaging Het
Tcl1b4 T C 12: 105,202,507 M10T possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Vmn2r60 C A 7: 42,194,962 A583D probably benign Het
Wdhd1 T C 14: 47,263,580 Q455R possibly damaging Het
Wdr17 A G 8: 54,632,311 probably null Het
Xbp1 T C 11: 5,524,798 L233P probably benign Het
Zbtb17 A G 4: 141,464,441 E288G probably benign Het
Other mutations in Steap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Steap3 APN 1 120241574 missense probably benign 0.02
IGL02307:Steap3 APN 1 120241660 nonsense probably null
IGL02413:Steap3 APN 1 120241772 missense probably damaging 0.99
IGL03237:Steap3 APN 1 120243790 missense probably damaging 1.00
R0076:Steap3 UTSW 1 120227730 missense probably damaging 1.00
R0157:Steap3 UTSW 1 120227649 makesense probably null
R0468:Steap3 UTSW 1 120234300 missense probably damaging 1.00
R0507:Steap3 UTSW 1 120241583 missense possibly damaging 0.78
R0727:Steap3 UTSW 1 120227817 missense possibly damaging 0.91
R0742:Steap3 UTSW 1 120241583 missense possibly damaging 0.78
R1439:Steap3 UTSW 1 120227820 missense probably damaging 1.00
R1728:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1728:Steap3 UTSW 1 120234378 missense probably benign
R1729:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1729:Steap3 UTSW 1 120234378 missense probably benign
R1730:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1730:Steap3 UTSW 1 120234378 missense probably benign
R1739:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1739:Steap3 UTSW 1 120234378 missense probably benign
R1762:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1762:Steap3 UTSW 1 120234378 missense probably benign
R1783:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1783:Steap3 UTSW 1 120234378 missense probably benign
R1785:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1785:Steap3 UTSW 1 120234378 missense probably benign
R1902:Steap3 UTSW 1 120241734 missense probably benign
R3827:Steap3 UTSW 1 120227730 missense probably damaging 1.00
R4574:Steap3 UTSW 1 120241456 missense probably benign 0.00
R4805:Steap3 UTSW 1 120243886 missense probably benign 0.04
R5176:Steap3 UTSW 1 120243767 critical splice donor site probably null
R5285:Steap3 UTSW 1 120241880 missense probably damaging 0.98
R5481:Steap3 UTSW 1 120241724 missense probably benign
R5906:Steap3 UTSW 1 120244001 missense probably damaging 1.00
R6038:Steap3 UTSW 1 120241641 missense probably damaging 1.00
R6922:Steap3 UTSW 1 120243894 missense probably damaging 1.00
R7258:Steap3 UTSW 1 120243986 missense possibly damaging 0.73
R7278:Steap3 UTSW 1 120234357 missense probably damaging 0.97
R7315:Steap3 UTSW 1 120227912 missense probably benign 0.01
R7439:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7440:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7441:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7444:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7452:Steap3 UTSW 1 120227855 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GCTTCACAGCCAGATTGACC -3'
(R):5'- AGGTAGAAGCCATACCCCTG -3'

Sequencing Primer
(F):5'- CAGATTGACCAGGTCGTAGC -3'
(R):5'- ATCCTGGAAGGTGCCCAC -3'
Posted On2017-08-16