Incidental Mutation 'R6038:Mrc1'
ID486659
Institutional Source Beutler Lab
Gene Symbol Mrc1
Ensembl Gene ENSMUSG00000026712
Gene Namemannose receptor, C type 1
SynonymsCD206, MR
MMRRC Submission 044208-MU
Accession Numbers

Ncbi RefSeq: NM_008625.2; MGI:97142

Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6038 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location14229392-14332057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 14257071 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 290 (W290C)
Ref Sequence ENSEMBL: ENSMUSP00000028045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028045]
PDB Structure
CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028045
AA Change: W290C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: W290C

DomainStartEndE-ValueType
RICIN 22 142 8.09e-18 SMART
FN2 161 209 1.83e-27 SMART
CLECT 216 341 8.87e-26 SMART
CLECT 362 487 3.51e-38 SMART
CLECT 504 626 8.2e-30 SMART
CLECT 646 778 2.34e-34 SMART
CLECT 800 923 2.17e-29 SMART
low complexity region 935 941 N/A INTRINSIC
CLECT 944 1079 3.35e-35 SMART
CLECT 1094 1212 4.11e-21 SMART
CLECT 1229 1355 3.63e-31 SMART
transmembrane domain 1388 1410 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104704
Meta Mutation Damage Score 0.646 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (65/65)
MGI Phenotype Strain: 2656742; 2448258
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,304,360 C1327R probably damaging Het
Adcy7 A G 8: 88,322,980 T704A probably benign Het
Adgra3 A T 5: 49,999,145 Y414* probably null Het
Adgrf1 T C 17: 43,295,209 S75P probably benign Het
Akirin1 A G 4: 123,750,163 M1T probably null Het
Antxr1 C A 6: 87,287,000 probably null Het
Arid1b A T 17: 5,336,682 Y1470F probably benign Het
Baiap3 T C 17: 25,246,334 D649G probably damaging Het
BC067074 G A 13: 113,318,619 V400M possibly damaging Het
Cabin1 A G 10: 75,739,366 V615A probably benign Het
Cntnap1 G A 11: 101,184,636 R880Q probably benign Het
Col28a1 T C 6: 8,013,140 T971A probably benign Het
Coro7 A T 16: 4,679,550 probably null Het
Defb19 T G 2: 152,576,267 probably null Het
Dnah17 T C 11: 118,055,889 D3045G probably benign Het
Dock4 A T 12: 40,733,351 probably null Het
Egln3 A G 12: 54,181,690 V210A probably damaging Het
Epb41l4a T C 18: 33,854,335 S330G probably benign Het
Epha7 G A 4: 28,821,521 E229K probably damaging Het
Fam71a C T 1: 191,162,722 E575K probably damaging Het
Fam71e1 C T 7: 44,500,295 R147W probably damaging Het
Fam71e2 T C 7: 4,753,595 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Gm29587 G A 12: 74,222,535 probably null Het
Gxylt2 T A 6: 100,804,594 L410Q probably damaging Het
H2-M10.3 C A 17: 36,368,395 C6F probably benign Het
Hecw1 G T 13: 14,346,062 Q197K probably benign Het
Hk3 T C 13: 55,006,560 M778V probably benign Het
Hydin A G 8: 110,599,031 T4691A probably benign Het
Larp1 A G 11: 58,041,605 E204G possibly damaging Het
Lrp12 A C 15: 39,872,380 W738G probably damaging Het
Mdga2 A T 12: 66,630,053 D488E probably damaging Het
Nhp2 T C 11: 51,620,085 V55A probably benign Het
Nrm T C 17: 35,861,505 S41P possibly damaging Het
Olfr1116 T A 2: 87,269,267 I141N possibly damaging Het
Olfr58 A G 9: 19,783,562 Y143C probably benign Het
Olfr741 T C 14: 50,486,220 L254P probably damaging Het
Osbpl7 C T 11: 97,050,716 P22S probably benign Het
Pebp1 A T 5: 117,284,105 L124Q probably benign Het
Pfkp G T 13: 6,597,969 H524N probably benign Het
Pnmt G A 11: 98,387,768 D187N probably damaging Het
Ppl A T 16: 5,102,581 I355K possibly damaging Het
Prom1 A T 5: 44,001,793 Y836N probably damaging Het
Rubcnl T C 14: 75,031,970 S23P probably benign Het
Sap130 T A 18: 31,680,486 I532N probably damaging Het
Serpina1e A T 12: 103,946,836 probably null Het
Skiv2l2 A T 13: 112,891,290 S679T probably benign Het
Slc12a3 T G 8: 94,330,472 S124R probably benign Het
Slc24a5 A G 2: 125,085,731 T317A probably benign Het
Smarcad1 T C 6: 65,073,248 S284P possibly damaging Het
Spag9 C G 11: 94,112,092 R724G probably damaging Het
Speg T C 1: 75,418,459 probably null Het
Steap3 A G 1: 120,241,641 Y271H probably damaging Het
Syne2 C T 12: 75,878,384 Q44* probably null Het
Tas2r114 A T 6: 131,689,481 C195S possibly damaging Het
Tcl1b4 T C 12: 105,202,507 M10T possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Vmn2r60 C A 7: 42,194,962 A583D probably benign Het
Wdhd1 T C 14: 47,263,580 Q455R possibly damaging Het
Wdr17 A G 8: 54,632,311 probably null Het
Xbp1 T C 11: 5,524,798 L233P probably benign Het
Zbtb17 A G 4: 141,464,441 E288G probably benign Het
Other mutations in Mrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Mrc1 APN 2 14328425 missense probably damaging 1.00
IGL01326:Mrc1 APN 2 14266524 missense probably damaging 1.00
IGL01340:Mrc1 APN 2 14310084 critical splice donor site probably null
IGL01758:Mrc1 APN 2 14238248 missense probably damaging 1.00
IGL01799:Mrc1 APN 2 14238376 missense probably damaging 1.00
IGL02280:Mrc1 APN 2 14244213 missense probably benign 0.19
IGL02435:Mrc1 APN 2 14248860 nonsense probably null
IGL03073:Mrc1 APN 2 14305342 missense probably damaging 1.00
IGL03110:Mrc1 APN 2 14293478 nonsense probably null
IGL03155:Mrc1 APN 2 14331101 missense probably benign 0.00
IGL03289:Mrc1 APN 2 14308823 critical splice donor site probably null
shug UTSW 2 14270206 missense probably damaging 1.00
sussigkeit UTSW 2 14325381 splice site probably null
R0011:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R0011:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R0066:Mrc1 UTSW 2 14261200 missense probably benign 0.42
R0066:Mrc1 UTSW 2 14261200 missense probably benign 0.42
R0110:Mrc1 UTSW 2 14238542 splice site probably benign
R0234:Mrc1 UTSW 2 14279894 missense possibly damaging 0.65
R0234:Mrc1 UTSW 2 14279894 missense possibly damaging 0.65
R0381:Mrc1 UTSW 2 14307909 missense probably benign 0.05
R0505:Mrc1 UTSW 2 14310032 missense probably damaging 1.00
R0539:Mrc1 UTSW 2 14270126 splice site probably benign
R0613:Mrc1 UTSW 2 14294819 missense probably damaging 0.96
R0626:Mrc1 UTSW 2 14328571 nonsense probably null
R1122:Mrc1 UTSW 2 14261336 critical splice donor site probably null
R1281:Mrc1 UTSW 2 14293510 missense probably damaging 1.00
R1399:Mrc1 UTSW 2 14279925 missense probably damaging 1.00
R1428:Mrc1 UTSW 2 14315263 missense probably benign 0.11
R1571:Mrc1 UTSW 2 14308733 missense probably damaging 0.97
R1596:Mrc1 UTSW 2 14248890 missense possibly damaging 0.91
R1730:Mrc1 UTSW 2 14327844 missense probably benign 0.01
R1733:Mrc1 UTSW 2 14257099 missense probably damaging 1.00
R1783:Mrc1 UTSW 2 14327844 missense probably benign 0.01
R1860:Mrc1 UTSW 2 14328579 missense probably benign 0.30
R1872:Mrc1 UTSW 2 14325381 splice site probably null
R1889:Mrc1 UTSW 2 14308677 critical splice acceptor site probably null
R1938:Mrc1 UTSW 2 14319241 missense possibly damaging 0.89
R1971:Mrc1 UTSW 2 14244292 critical splice donor site probably null
R2031:Mrc1 UTSW 2 14321773 missense probably damaging 1.00
R2136:Mrc1 UTSW 2 14270189 missense probably damaging 1.00
R2152:Mrc1 UTSW 2 14327864 missense probably damaging 1.00
R2168:Mrc1 UTSW 2 14244204 missense possibly damaging 0.90
R2273:Mrc1 UTSW 2 14325372 missense probably damaging 1.00
R2901:Mrc1 UTSW 2 14328543 missense possibly damaging 0.94
R3767:Mrc1 UTSW 2 14319170 missense probably damaging 1.00
R3795:Mrc1 UTSW 2 14288982 splice site probably benign
R4028:Mrc1 UTSW 2 14238248 missense probably damaging 1.00
R4668:Mrc1 UTSW 2 14293486 missense probably damaging 1.00
R4828:Mrc1 UTSW 2 14270206 missense probably damaging 1.00
R4897:Mrc1 UTSW 2 14319141 missense probably benign 0.01
R4950:Mrc1 UTSW 2 14271280 missense probably damaging 1.00
R5000:Mrc1 UTSW 2 14244189 missense probably damaging 1.00
R5068:Mrc1 UTSW 2 14306516 missense probably benign 0.00
R5279:Mrc1 UTSW 2 14310058 missense probably damaging 0.99
R5366:Mrc1 UTSW 2 14321914 missense probably benign 0.03
R5436:Mrc1 UTSW 2 14266515 missense probably damaging 1.00
R5552:Mrc1 UTSW 2 14279957 missense probably benign 0.05
R5631:Mrc1 UTSW 2 14328572 nonsense probably null
R5831:Mrc1 UTSW 2 14308712 missense probably damaging 0.99
R5978:Mrc1 UTSW 2 14315393 missense probably damaging 0.97
R5993:Mrc1 UTSW 2 14305327 missense probably damaging 1.00
R6030:Mrc1 UTSW 2 14316901 missense probably benign 0.04
R6030:Mrc1 UTSW 2 14316901 missense probably benign 0.04
R6038:Mrc1 UTSW 2 14257071 missense probably damaging 1.00
R6228:Mrc1 UTSW 2 14271304 missense probably benign 0.08
R6344:Mrc1 UTSW 2 14244174 missense probably damaging 1.00
R6457:Mrc1 UTSW 2 14270205 missense probably damaging 1.00
R6520:Mrc1 UTSW 2 14307949 missense probably damaging 1.00
R6619:Mrc1 UTSW 2 14294786 splice site probably null
R6631:Mrc1 UTSW 2 14238485 missense probably benign
R6737:Mrc1 UTSW 2 14271277 missense possibly damaging 0.95
R6782:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R6887:Mrc1 UTSW 2 14325237 missense possibly damaging 0.94
R7108:Mrc1 UTSW 2 14304146 nonsense probably null
R7120:Mrc1 UTSW 2 14308697 missense probably damaging 0.97
R7460:Mrc1 UTSW 2 14248869 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGATATTAATCACTACTTCCCTC -3'
(R):5'- TGCAGATTCCAAAGCATGATGG -3'

Sequencing Primer
(F):5'- GTGCTAGTAACCTAACTAGGGTCC -3'
(R):5'- GCATGATGGAAAATGAGCTATGTTC -3'
Posted On2017-08-16