Incidental Mutation 'R6038:Pebp1'
ID486668
Institutional Source Beutler Lab
Gene Symbol Pebp1
Ensembl Gene ENSMUSG00000032959
Gene Namephosphatidylethanolamine binding protein 1
SynonymsRKIP, Pbp1, Raf-1 inhibitor protein, Pbpr, Pebp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6038 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location117282654-117287625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117284105 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 124 (L124Q)
Ref Sequence ENSEMBL: ENSMUSP00000107604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036951] [ENSMUST00000111973] [ENSMUST00000142428]
Predicted Effect probably benign
Transcript: ENSMUST00000036951
SMART Domains Protein: ENSMUSP00000048425
Gene: ENSMUSG00000032959

DomainStartEndE-ValueType
Pfam:PBP 22 170 3.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111973
AA Change: L124Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107604
Gene: ENSMUSG00000032959
AA Change: L124Q

DomainStartEndE-ValueType
Pfam:PBP 29 117 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139913
Predicted Effect probably benign
Transcript: ENSMUST00000142428
SMART Domains Protein: ENSMUSP00000116186
Gene: ENSMUSG00000032959

DomainStartEndE-ValueType
Pfam:PBP 22 122 8.4e-21 PFAM
Meta Mutation Damage Score 0.1624 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatidylethanolamine-binding family of proteins and has been shown to modulate multiple signaling pathways, including the MAP kinase (MAPK), NF-kappa B, and glycogen synthase kinase-3 (GSK-3) signaling pathways. The encoded protein can be further processed to form a smaller cleavage product, hippocampal cholinergic neurostimulating peptide (HCNP), which may be involved in neural development. This gene has been implicated in numerous human cancers and may act as a metastasis suppressor gene. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit age-related decrease in olfactory function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,304,360 C1327R probably damaging Het
Adcy7 A G 8: 88,322,980 T704A probably benign Het
Adgra3 A T 5: 49,999,145 Y414* probably null Het
Adgrf1 T C 17: 43,295,209 S75P probably benign Het
Akirin1 A G 4: 123,750,163 M1T probably null Het
Antxr1 C A 6: 87,287,000 probably null Het
Arid1b A T 17: 5,336,682 Y1470F probably benign Het
Baiap3 T C 17: 25,246,334 D649G probably damaging Het
BC067074 G A 13: 113,318,619 V400M possibly damaging Het
Cabin1 A G 10: 75,739,366 V615A probably benign Het
Cntnap1 G A 11: 101,184,636 R880Q probably benign Het
Col28a1 T C 6: 8,013,140 T971A probably benign Het
Coro7 A T 16: 4,679,550 probably null Het
Defb19 T G 2: 152,576,267 probably null Het
Dnah17 T C 11: 118,055,889 D3045G probably benign Het
Dock4 A T 12: 40,733,351 probably null Het
Egln3 A G 12: 54,181,690 V210A probably damaging Het
Epb41l4a T C 18: 33,854,335 S330G probably benign Het
Epha7 G A 4: 28,821,521 E229K probably damaging Het
Fam71a C T 1: 191,162,722 E575K probably damaging Het
Fam71e1 C T 7: 44,500,295 R147W probably damaging Het
Fam71e2 T C 7: 4,753,595 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Gm29587 G A 12: 74,222,535 probably null Het
Gxylt2 T A 6: 100,804,594 L410Q probably damaging Het
H2-M10.3 C A 17: 36,368,395 C6F probably benign Het
Hecw1 G T 13: 14,346,062 Q197K probably benign Het
Hk3 T C 13: 55,006,560 M778V probably benign Het
Hydin A G 8: 110,599,031 T4691A probably benign Het
Larp1 A G 11: 58,041,605 E204G possibly damaging Het
Lrp12 A C 15: 39,872,380 W738G probably damaging Het
Mdga2 A T 12: 66,630,053 D488E probably damaging Het
Mrc1 G C 2: 14,257,071 W290C probably damaging Het
Nhp2 T C 11: 51,620,085 V55A probably benign Het
Nrm T C 17: 35,861,505 S41P possibly damaging Het
Olfr1116 T A 2: 87,269,267 I141N possibly damaging Het
Olfr58 A G 9: 19,783,562 Y143C probably benign Het
Olfr741 T C 14: 50,486,220 L254P probably damaging Het
Osbpl7 C T 11: 97,050,716 P22S probably benign Het
Pfkp G T 13: 6,597,969 H524N probably benign Het
Pnmt G A 11: 98,387,768 D187N probably damaging Het
Ppl A T 16: 5,102,581 I355K possibly damaging Het
Prom1 A T 5: 44,001,793 Y836N probably damaging Het
Rubcnl T C 14: 75,031,970 S23P probably benign Het
Sap130 T A 18: 31,680,486 I532N probably damaging Het
Serpina1e A T 12: 103,946,836 probably null Het
Skiv2l2 A T 13: 112,891,290 S679T probably benign Het
Slc12a3 T G 8: 94,330,472 S124R probably benign Het
Slc24a5 A G 2: 125,085,731 T317A probably benign Het
Smarcad1 T C 6: 65,073,248 S284P possibly damaging Het
Spag9 C G 11: 94,112,092 R724G probably damaging Het
Speg T C 1: 75,418,459 probably null Het
Steap3 A G 1: 120,241,641 Y271H probably damaging Het
Syne2 C T 12: 75,878,384 Q44* probably null Het
Tas2r114 A T 6: 131,689,481 C195S possibly damaging Het
Tcl1b4 T C 12: 105,202,507 M10T possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Vmn2r60 C A 7: 42,194,962 A583D probably benign Het
Wdhd1 T C 14: 47,263,580 Q455R possibly damaging Het
Wdr17 A G 8: 54,632,311 probably null Het
Xbp1 T C 11: 5,524,798 L233P probably benign Het
Zbtb17 A G 4: 141,464,441 E288G probably benign Het
Other mutations in Pebp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1575:Pebp1 UTSW 5 117286164 missense possibly damaging 0.93
R4595:Pebp1 UTSW 5 117283410 missense probably benign 0.11
R5072:Pebp1 UTSW 5 117283410 missense probably benign 0.11
R6038:Pebp1 UTSW 5 117284105 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACCAGCCAGCCAGTCAGTC -3'
(R):5'- TGTGACTGTGGACTGCACG -3'

Sequencing Primer
(F):5'- GGATCAAGAGTTCAGGATCACTCTC -3'
(R):5'- ACTGCACGGTCCAGCCTTC -3'
Posted On2017-08-16