Incidental Mutation 'R6038:Col28a1'
ID486669
Institutional Source Beutler Lab
Gene Symbol Col28a1
Ensembl Gene ENSMUSG00000068794
Gene Namecollagen, type XXVIII, alpha 1
SynonymsCol28; Gm466
MMRRC Submission 044208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6038 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location7997808-8192617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8013140 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 971 (T971A)
Ref Sequence ENSEMBL: ENSMUSP00000111199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115537]
Predicted Effect probably benign
Transcript: ENSMUST00000115537
AA Change: T971A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111199
Gene: ENSMUSG00000068794
AA Change: T971A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 46 225 8.08e-18 SMART
low complexity region 245 260 N/A INTRINSIC
internal_repeat_1 261 304 1.56e-15 PROSPERO
low complexity region 306 363 N/A INTRINSIC
low complexity region 375 422 N/A INTRINSIC
low complexity region 438 479 N/A INTRINSIC
internal_repeat_4 481 531 4.11e-8 PROSPERO
Pfam:Collagen 534 591 1.5e-8 PFAM
low complexity region 640 661 N/A INTRINSIC
low complexity region 667 684 N/A INTRINSIC
internal_repeat_4 690 739 4.11e-8 PROSPERO
internal_repeat_1 711 763 1.56e-15 PROSPERO
internal_repeat_5 713 769 4.35e-6 PROSPERO
low complexity region 771 789 N/A INTRINSIC
VWA 796 973 1.57e-38 SMART
KU 1086 1139 8.16e-20 SMART
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL28A1 belongs to a class of collagens containing von Willebrand factor (VWF; MIM 613160) type A (VWFA) domains (Veit et al., 2006 [PubMed 16330543]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,304,360 C1327R probably damaging Het
Adcy7 A G 8: 88,322,980 T704A probably benign Het
Adgra3 A T 5: 49,999,145 Y414* probably null Het
Adgrf1 T C 17: 43,295,209 S75P probably benign Het
Akirin1 A G 4: 123,750,163 M1T probably null Het
Antxr1 C A 6: 87,287,000 probably null Het
Arid1b A T 17: 5,336,682 Y1470F probably benign Het
Baiap3 T C 17: 25,246,334 D649G probably damaging Het
BC067074 G A 13: 113,318,619 V400M possibly damaging Het
Cabin1 A G 10: 75,739,366 V615A probably benign Het
Cntnap1 G A 11: 101,184,636 R880Q probably benign Het
Coro7 A T 16: 4,679,550 probably null Het
Defb19 T G 2: 152,576,267 probably null Het
Dnah17 T C 11: 118,055,889 D3045G probably benign Het
Dock4 A T 12: 40,733,351 probably null Het
Egln3 A G 12: 54,181,690 V210A probably damaging Het
Epb41l4a T C 18: 33,854,335 S330G probably benign Het
Epha7 G A 4: 28,821,521 E229K probably damaging Het
Fam71a C T 1: 191,162,722 E575K probably damaging Het
Fam71e1 C T 7: 44,500,295 R147W probably damaging Het
Fam71e2 T C 7: 4,753,595 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Gm29587 G A 12: 74,222,535 probably null Het
Gxylt2 T A 6: 100,804,594 L410Q probably damaging Het
H2-M10.3 C A 17: 36,368,395 C6F probably benign Het
Hecw1 G T 13: 14,346,062 Q197K probably benign Het
Hk3 T C 13: 55,006,560 M778V probably benign Het
Hydin A G 8: 110,599,031 T4691A probably benign Het
Larp1 A G 11: 58,041,605 E204G possibly damaging Het
Lrp12 A C 15: 39,872,380 W738G probably damaging Het
Mdga2 A T 12: 66,630,053 D488E probably damaging Het
Mrc1 G C 2: 14,257,071 W290C probably damaging Het
Nhp2 T C 11: 51,620,085 V55A probably benign Het
Nrm T C 17: 35,861,505 S41P possibly damaging Het
Olfr1116 T A 2: 87,269,267 I141N possibly damaging Het
Olfr58 A G 9: 19,783,562 Y143C probably benign Het
Olfr741 T C 14: 50,486,220 L254P probably damaging Het
Osbpl7 C T 11: 97,050,716 P22S probably benign Het
Pebp1 A T 5: 117,284,105 L124Q probably benign Het
Pfkp G T 13: 6,597,969 H524N probably benign Het
Pnmt G A 11: 98,387,768 D187N probably damaging Het
Ppl A T 16: 5,102,581 I355K possibly damaging Het
Prom1 A T 5: 44,001,793 Y836N probably damaging Het
Rubcnl T C 14: 75,031,970 S23P probably benign Het
Sap130 T A 18: 31,680,486 I532N probably damaging Het
Serpina1e A T 12: 103,946,836 probably null Het
Skiv2l2 A T 13: 112,891,290 S679T probably benign Het
Slc12a3 T G 8: 94,330,472 S124R probably benign Het
Slc24a5 A G 2: 125,085,731 T317A probably benign Het
Smarcad1 T C 6: 65,073,248 S284P possibly damaging Het
Spag9 C G 11: 94,112,092 R724G probably damaging Het
Speg T C 1: 75,418,459 probably null Het
Steap3 A G 1: 120,241,641 Y271H probably damaging Het
Syne2 C T 12: 75,878,384 Q44* probably null Het
Tas2r114 A T 6: 131,689,481 C195S possibly damaging Het
Tcl1b4 T C 12: 105,202,507 M10T possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Vmn2r60 C A 7: 42,194,962 A583D probably benign Het
Wdhd1 T C 14: 47,263,580 Q455R possibly damaging Het
Wdr17 A G 8: 54,632,311 probably null Het
Xbp1 T C 11: 5,524,798 L233P probably benign Het
Zbtb17 A G 4: 141,464,441 E288G probably benign Het
Other mutations in Col28a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Col28a1 APN 6 8014795 missense probably damaging 1.00
IGL00329:Col28a1 APN 6 8175425 missense probably damaging 1.00
IGL00466:Col28a1 APN 6 8022081 splice site probably benign
IGL00544:Col28a1 APN 6 8162228 critical splice acceptor site probably null
IGL00979:Col28a1 APN 6 8014810 missense probably damaging 1.00
IGL01475:Col28a1 APN 6 8103521 missense probably damaging 0.98
IGL01570:Col28a1 APN 6 8014540 missense probably damaging 0.99
IGL01688:Col28a1 APN 6 7998517 missense probably damaging 1.00
IGL01734:Col28a1 APN 6 8158134 missense probably damaging 0.99
IGL01911:Col28a1 APN 6 8014963 missense probably damaging 1.00
IGL01922:Col28a1 APN 6 8158133 missense probably damaging 0.96
IGL02567:Col28a1 APN 6 8014819 missense possibly damaging 0.91
IGL02641:Col28a1 APN 6 8014794 nonsense probably null
IGL02893:Col28a1 APN 6 8103534 missense probably damaging 1.00
IGL03062:Col28a1 APN 6 8017029 splice site probably benign
IGL03273:Col28a1 APN 6 8103484 splice site probably benign
P0043:Col28a1 UTSW 6 8168152 unclassified probably benign
R0034:Col28a1 UTSW 6 8175708 missense probably benign 0.32
R0543:Col28a1 UTSW 6 8075326 splice site probably benign
R0646:Col28a1 UTSW 6 8175291 missense possibly damaging 0.88
R0726:Col28a1 UTSW 6 8014495 critical splice donor site probably null
R1013:Col28a1 UTSW 6 7999452 splice site probably benign
R1054:Col28a1 UTSW 6 8175534 missense probably damaging 0.96
R1671:Col28a1 UTSW 6 8083773 missense possibly damaging 0.84
R1804:Col28a1 UTSW 6 8164612 critical splice donor site probably null
R1853:Col28a1 UTSW 6 8014574 missense probably benign 0.03
R1906:Col28a1 UTSW 6 7999644 missense probably benign 0.14
R1914:Col28a1 UTSW 6 8176333 missense probably benign 0.08
R1915:Col28a1 UTSW 6 8176333 missense probably benign 0.08
R1954:Col28a1 UTSW 6 7998516 missense probably damaging 1.00
R1997:Col28a1 UTSW 6 7999644 missense probably benign 0.14
R2011:Col28a1 UTSW 6 8059360 missense probably benign 0.05
R2023:Col28a1 UTSW 6 8083783 missense possibly damaging 0.66
R2149:Col28a1 UTSW 6 8155383 missense possibly damaging 0.83
R2285:Col28a1 UTSW 6 8097078 missense probably damaging 0.98
R2403:Col28a1 UTSW 6 8175641 missense possibly damaging 0.79
R3615:Col28a1 UTSW 6 8014942 missense probably damaging 1.00
R3616:Col28a1 UTSW 6 8014942 missense probably damaging 1.00
R3837:Col28a1 UTSW 6 8014601 missense possibly damaging 0.81
R4042:Col28a1 UTSW 6 8014678 missense probably damaging 0.98
R4084:Col28a1 UTSW 6 8013131 nonsense probably null
R4084:Col28a1 UTSW 6 8013132 missense possibly damaging 0.49
R4417:Col28a1 UTSW 6 8175666 missense possibly damaging 0.62
R4838:Col28a1 UTSW 6 8014559 missense probably benign 0.11
R5752:Col28a1 UTSW 6 8015025 missense possibly damaging 0.79
R5807:Col28a1 UTSW 6 8158144 missense probably benign 0.00
R6038:Col28a1 UTSW 6 8013140 missense probably benign 0.03
R6046:Col28a1 UTSW 6 8168102 splice site probably null
R6054:Col28a1 UTSW 6 8083748 missense possibly damaging 0.96
R6159:Col28a1 UTSW 6 8162247 intron probably null
R6306:Col28a1 UTSW 6 8014969 missense probably damaging 0.96
R6379:Col28a1 UTSW 6 8012996 missense probably benign 0.00
R6665:Col28a1 UTSW 6 8062277 missense probably benign 0.08
R6809:Col28a1 UTSW 6 7999468 missense probably damaging 0.99
R7023:Col28a1 UTSW 6 8083763 missense possibly damaging 0.92
R7101:Col28a1 UTSW 6 8014795 missense possibly damaging 0.95
R7117:Col28a1 UTSW 6 8013122 missense possibly damaging 0.89
R7375:Col28a1 UTSW 6 7998499 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CTTTAAGTGTGAGGAGTGAGCC -3'
(R):5'- TTCTGCCTGCTGTGCTAGAG -3'

Sequencing Primer
(F):5'- GCCAACAGCTACTTACCGACTTAG -3'
(R):5'- CAAATAACGGGAGGTAGCT -3'
Posted On2017-08-16