Incidental Mutation 'R6038:Slc12a3'
ID486679
Institutional Source Beutler Lab
Gene Symbol Slc12a3
Ensembl Gene ENSMUSG00000031766
Gene Namesolute carrier family 12, member 3
SynonymsNCC, TSC
MMRRC Submission 044208-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6038 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94329201-94366214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 94330472 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 124 (S124R)
Ref Sequence ENSEMBL: ENSMUSP00000148455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034218] [ENSMUST00000212134]
Predicted Effect probably benign
Transcript: ENSMUST00000034218
AA Change: S124R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034218
Gene: ENSMUSG00000031766
AA Change: S124R

DomainStartEndE-ValueType
Pfam:AA_permease_N 43 114 1.5e-30 PFAM
Pfam:AA_permease 139 645 3.6e-145 PFAM
Pfam:SLC12 653 801 1.4e-53 PFAM
Pfam:SLC12 787 1001 2e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212041
Predicted Effect probably benign
Transcript: ENSMUST00000212134
AA Change: S124R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212800
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a renal thiazide-sensitive sodium-chloride cotransporter that is important for electrolyte homeostasis. This cotransporter mediates sodium and chloride reabsorption in the distal convoluted tubule. Mutations in this gene cause Gitelman syndrome, a disease similar to Bartter's syndrome, that is characterized by hypokalemic alkalosis combined with hypomagnesemia, low urinary calcium, and increased renin activity associated with normal blood pressure. This cotransporter is the target for thiazide diuretics that are used for treating high blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomagnesemia, hypocalciurua and abnormal renal distal convoluted tubule morphology, and show significantly reduced arterial blood pressure on a sodium-depleted diet. Mutant kidney cortical collecting ductsdisplay thiazide-sensitive NaCl absorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,304,360 C1327R probably damaging Het
Adcy7 A G 8: 88,322,980 T704A probably benign Het
Adgra3 A T 5: 49,999,145 Y414* probably null Het
Adgrf1 T C 17: 43,295,209 S75P probably benign Het
Akirin1 A G 4: 123,750,163 M1T probably null Het
Antxr1 C A 6: 87,287,000 probably null Het
Arid1b A T 17: 5,336,682 Y1470F probably benign Het
Baiap3 T C 17: 25,246,334 D649G probably damaging Het
BC067074 G A 13: 113,318,619 V400M possibly damaging Het
Cabin1 A G 10: 75,739,366 V615A probably benign Het
Cntnap1 G A 11: 101,184,636 R880Q probably benign Het
Col28a1 T C 6: 8,013,140 T971A probably benign Het
Coro7 A T 16: 4,679,550 probably null Het
Defb19 T G 2: 152,576,267 probably null Het
Dnah17 T C 11: 118,055,889 D3045G probably benign Het
Dock4 A T 12: 40,733,351 probably null Het
Egln3 A G 12: 54,181,690 V210A probably damaging Het
Epb41l4a T C 18: 33,854,335 S330G probably benign Het
Epha7 G A 4: 28,821,521 E229K probably damaging Het
Fam71a C T 1: 191,162,722 E575K probably damaging Het
Fam71e1 C T 7: 44,500,295 R147W probably damaging Het
Fam71e2 T C 7: 4,753,595 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Gm29587 G A 12: 74,222,535 probably null Het
Gxylt2 T A 6: 100,804,594 L410Q probably damaging Het
H2-M10.3 C A 17: 36,368,395 C6F probably benign Het
Hecw1 G T 13: 14,346,062 Q197K probably benign Het
Hk3 T C 13: 55,006,560 M778V probably benign Het
Hydin A G 8: 110,599,031 T4691A probably benign Het
Larp1 A G 11: 58,041,605 E204G possibly damaging Het
Lrp12 A C 15: 39,872,380 W738G probably damaging Het
Mdga2 A T 12: 66,630,053 D488E probably damaging Het
Mrc1 G C 2: 14,257,071 W290C probably damaging Het
Nhp2 T C 11: 51,620,085 V55A probably benign Het
Nrm T C 17: 35,861,505 S41P possibly damaging Het
Olfr1116 T A 2: 87,269,267 I141N possibly damaging Het
Olfr58 A G 9: 19,783,562 Y143C probably benign Het
Olfr741 T C 14: 50,486,220 L254P probably damaging Het
Osbpl7 C T 11: 97,050,716 P22S probably benign Het
Pebp1 A T 5: 117,284,105 L124Q probably benign Het
Pfkp G T 13: 6,597,969 H524N probably benign Het
Pnmt G A 11: 98,387,768 D187N probably damaging Het
Ppl A T 16: 5,102,581 I355K possibly damaging Het
Prom1 A T 5: 44,001,793 Y836N probably damaging Het
Rubcnl T C 14: 75,031,970 S23P probably benign Het
Sap130 T A 18: 31,680,486 I532N probably damaging Het
Serpina1e A T 12: 103,946,836 probably null Het
Skiv2l2 A T 13: 112,891,290 S679T probably benign Het
Slc24a5 A G 2: 125,085,731 T317A probably benign Het
Smarcad1 T C 6: 65,073,248 S284P possibly damaging Het
Spag9 C G 11: 94,112,092 R724G probably damaging Het
Speg T C 1: 75,418,459 probably null Het
Steap3 A G 1: 120,241,641 Y271H probably damaging Het
Syne2 C T 12: 75,878,384 Q44* probably null Het
Tas2r114 A T 6: 131,689,481 C195S possibly damaging Het
Tcl1b4 T C 12: 105,202,507 M10T possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Vmn2r60 C A 7: 42,194,962 A583D probably benign Het
Wdhd1 T C 14: 47,263,580 Q455R possibly damaging Het
Wdr17 A G 8: 54,632,311 probably null Het
Xbp1 T C 11: 5,524,798 L233P probably benign Het
Zbtb17 A G 4: 141,464,441 E288G probably benign Het
Other mutations in Slc12a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Slc12a3 APN 8 94357096 missense probably benign 0.00
IGL01947:Slc12a3 APN 8 94365819 critical splice acceptor site probably null
IGL02151:Slc12a3 APN 8 94348592 missense probably benign 0.26
IGL02440:Slc12a3 APN 8 94331682 missense probably damaging 1.00
IGL03213:Slc12a3 APN 8 94335305 missense possibly damaging 0.95
IGL03260:Slc12a3 APN 8 94333242 missense probably damaging 1.00
IGL03306:Slc12a3 APN 8 94351758 missense possibly damaging 0.72
IGL03329:Slc12a3 APN 8 94365891 missense possibly damaging 0.67
Pugilist UTSW 8 94345773 critical splice acceptor site probably null
R0131:Slc12a3 UTSW 8 94340883 splice site probably benign
R0189:Slc12a3 UTSW 8 94356358 missense probably benign 0.30
R0330:Slc12a3 UTSW 8 94346346 missense possibly damaging 0.75
R0569:Slc12a3 UTSW 8 94330525 critical splice donor site probably null
R0715:Slc12a3 UTSW 8 94329433 missense possibly damaging 0.75
R1248:Slc12a3 UTSW 8 94333277 missense probably damaging 1.00
R1565:Slc12a3 UTSW 8 94345877 missense possibly damaging 0.75
R2068:Slc12a3 UTSW 8 94345828 missense probably damaging 1.00
R2108:Slc12a3 UTSW 8 94340530 missense probably damaging 0.97
R2273:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2274:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2275:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2433:Slc12a3 UTSW 8 94346316 missense probably benign 0.00
R3770:Slc12a3 UTSW 8 94353040 missense probably benign
R4429:Slc12a3 UTSW 8 94343085 missense probably damaging 1.00
R4431:Slc12a3 UTSW 8 94343085 missense probably damaging 1.00
R4533:Slc12a3 UTSW 8 94357086 missense probably null 0.02
R4627:Slc12a3 UTSW 8 94329384 missense probably benign
R4856:Slc12a3 UTSW 8 94351810 critical splice donor site probably null
R4886:Slc12a3 UTSW 8 94351810 critical splice donor site probably null
R4908:Slc12a3 UTSW 8 94348588 missense possibly damaging 0.76
R5054:Slc12a3 UTSW 8 94346351 missense probably damaging 1.00
R5299:Slc12a3 UTSW 8 94351789 missense probably damaging 1.00
R5451:Slc12a3 UTSW 8 94357027 missense possibly damaging 0.61
R5590:Slc12a3 UTSW 8 94345788 missense probably damaging 1.00
R5725:Slc12a3 UTSW 8 94330446 missense probably benign 0.00
R6038:Slc12a3 UTSW 8 94330472 missense probably benign 0.01
R6162:Slc12a3 UTSW 8 94345773 critical splice acceptor site probably null
R6266:Slc12a3 UTSW 8 94358471 missense possibly damaging 0.93
R6489:Slc12a3 UTSW 8 94335004 missense possibly damaging 0.96
R6521:Slc12a3 UTSW 8 94343113 missense possibly damaging 0.84
R6882:Slc12a3 UTSW 8 94365918 missense possibly damaging 0.51
R7051:Slc12a3 UTSW 8 94365944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAGTAGCATTGTACCCAGG -3'
(R):5'- AACTGAGGCCCAAACTGAG -3'

Sequencing Primer
(F):5'- ATTGTACCCAGGAAGCTGTC -3'
(R):5'- TGAGCTCCAGGTCTAAACTGC -3'
Posted On2017-08-16