Incidental Mutation 'R6038:Serpina1e'
ID486697
Institutional Source Beutler Lab
Gene Symbol Serpina1e
Ensembl Gene ENSMUSG00000072849
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 1E
SynonymsSpi1-5, PI5
MMRRC Submission 044208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6038 (G1)
Quality Score140.008
Status Validated
Chromosome12
Chromosomal Location103946931-103958975 bp(-) (GRCm38)
Type of Mutationunclassified (95 bp from exon)
DNA Base Change (assembly) A to T at 103946836 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085054] [ENSMUST00000122229]
Predicted Effect probably null
Transcript: ENSMUST00000085054
SMART Domains Protein: ENSMUSP00000082130
Gene: ENSMUSG00000072849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
SERPIN 53 410 3.17e-200 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122229
SMART Domains Protein: ENSMUSP00000113606
Gene: ENSMUSG00000072849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
SERPIN 53 410 3.17e-200 SMART
Meta Mutation Damage Score 0.6016 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,304,360 C1327R probably damaging Het
Adcy7 A G 8: 88,322,980 T704A probably benign Het
Adgra3 A T 5: 49,999,145 Y414* probably null Het
Adgrf1 T C 17: 43,295,209 S75P probably benign Het
Akirin1 A G 4: 123,750,163 M1T probably null Het
Antxr1 C A 6: 87,287,000 probably null Het
Arid1b A T 17: 5,336,682 Y1470F probably benign Het
Baiap3 T C 17: 25,246,334 D649G probably damaging Het
BC067074 G A 13: 113,318,619 V400M possibly damaging Het
Cabin1 A G 10: 75,739,366 V615A probably benign Het
Cntnap1 G A 11: 101,184,636 R880Q probably benign Het
Col28a1 T C 6: 8,013,140 T971A probably benign Het
Coro7 A T 16: 4,679,550 probably null Het
Defb19 T G 2: 152,576,267 probably null Het
Dnah17 T C 11: 118,055,889 D3045G probably benign Het
Dock4 A T 12: 40,733,351 probably null Het
Egln3 A G 12: 54,181,690 V210A probably damaging Het
Epb41l4a T C 18: 33,854,335 S330G probably benign Het
Epha7 G A 4: 28,821,521 E229K probably damaging Het
Fam71a C T 1: 191,162,722 E575K probably damaging Het
Fam71e1 C T 7: 44,500,295 R147W probably damaging Het
Fam71e2 T C 7: 4,753,595 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Gm29587 G A 12: 74,222,535 probably null Het
Gxylt2 T A 6: 100,804,594 L410Q probably damaging Het
H2-M10.3 C A 17: 36,368,395 C6F probably benign Het
Hecw1 G T 13: 14,346,062 Q197K probably benign Het
Hk3 T C 13: 55,006,560 M778V probably benign Het
Hydin A G 8: 110,599,031 T4691A probably benign Het
Larp1 A G 11: 58,041,605 E204G possibly damaging Het
Lrp12 A C 15: 39,872,380 W738G probably damaging Het
Mdga2 A T 12: 66,630,053 D488E probably damaging Het
Mrc1 G C 2: 14,257,071 W290C probably damaging Het
Nhp2 T C 11: 51,620,085 V55A probably benign Het
Nrm T C 17: 35,861,505 S41P possibly damaging Het
Olfr1116 T A 2: 87,269,267 I141N possibly damaging Het
Olfr58 A G 9: 19,783,562 Y143C probably benign Het
Olfr741 T C 14: 50,486,220 L254P probably damaging Het
Osbpl7 C T 11: 97,050,716 P22S probably benign Het
Pebp1 A T 5: 117,284,105 L124Q probably benign Het
Pfkp G T 13: 6,597,969 H524N probably benign Het
Pnmt G A 11: 98,387,768 D187N probably damaging Het
Ppl A T 16: 5,102,581 I355K possibly damaging Het
Prom1 A T 5: 44,001,793 Y836N probably damaging Het
Rubcnl T C 14: 75,031,970 S23P probably benign Het
Sap130 T A 18: 31,680,486 I532N probably damaging Het
Skiv2l2 A T 13: 112,891,290 S679T probably benign Het
Slc12a3 T G 8: 94,330,472 S124R probably benign Het
Slc24a5 A G 2: 125,085,731 T317A probably benign Het
Smarcad1 T C 6: 65,073,248 S284P possibly damaging Het
Spag9 C G 11: 94,112,092 R724G probably damaging Het
Speg T C 1: 75,418,459 probably null Het
Steap3 A G 1: 120,241,641 Y271H probably damaging Het
Syne2 C T 12: 75,878,384 Q44* probably null Het
Tas2r114 A T 6: 131,689,481 C195S possibly damaging Het
Tcl1b4 T C 12: 105,202,507 M10T possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Vmn2r60 C A 7: 42,194,962 A583D probably benign Het
Wdhd1 T C 14: 47,263,580 Q455R possibly damaging Het
Wdr17 A G 8: 54,632,311 probably null Het
Xbp1 T C 11: 5,524,798 L233P probably benign Het
Zbtb17 A G 4: 141,464,441 E288G probably benign Het
Other mutations in Serpina1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02249:Serpina1e APN 12 103951134 missense probably benign 0.22
IGL03186:Serpina1e APN 12 103949203 missense probably benign 0.05
R0517:Serpina1e UTSW 12 103949227 missense probably benign 0.00
R0529:Serpina1e UTSW 12 103949104 missense probably damaging 1.00
R0547:Serpina1e UTSW 12 103949191 missense probably benign
R1797:Serpina1e UTSW 12 103950891 missense probably benign 0.21
R1964:Serpina1e UTSW 12 103951207 missense probably damaging 0.99
R2311:Serpina1e UTSW 12 103951129 missense possibly damaging 0.95
R3889:Serpina1e UTSW 12 103950873 missense probably damaging 1.00
R4671:Serpina1e UTSW 12 103948082 missense probably damaging 0.98
R5518:Serpina1e UTSW 12 103950828 missense probably damaging 0.99
R6038:Serpina1e UTSW 12 103946836 unclassified probably null
R6150:Serpina1e UTSW 12 103950807 missense probably benign
R6826:Serpina1e UTSW 12 103949138 missense probably benign 0.30
R7002:Serpina1e UTSW 12 103948079 missense probably benign 0.00
R7144:Serpina1e UTSW 12 103947018 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACCCTGAGTCTTTGAGCATG -3'
(R):5'- AGTCATCCTTCCTTCTGAATTGGG -3'

Sequencing Primer
(F):5'- ACCCTGAGTCTTTGAGCATGAACTG -3'
(R):5'- GGGTTCCTTTCCATTAAACACGGG -3'
Posted On2017-08-16