Incidental Mutation 'R6038:Hk3'
ID486701
Institutional Source Beutler Lab
Gene Symbol Hk3
Ensembl Gene ENSMUSG00000025877
Gene Namehexokinase 3
Synonyms
MMRRC Submission 044208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6038 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location55005985-55021385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55006560 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 778 (M778V)
Ref Sequence ENSEMBL: ENSMUSP00000116717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026994] [ENSMUST00000052949] [ENSMUST00000109994] [ENSMUST00000123097] [ENSMUST00000126234] [ENSMUST00000132309] [ENSMUST00000137967] [ENSMUST00000153665]
Predicted Effect probably benign
Transcript: ENSMUST00000026994
SMART Domains Protein: ENSMUSP00000026994
Gene: ENSMUSG00000025876

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 296 1.25e-14 SMART
TSP1 301 350 1.98e-8 SMART
transmembrane domain 360 382 N/A INTRINSIC
ZU5 495 598 3.68e-58 SMART
DEATH 805 896 5.86e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052949
AA Change: M823V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000051215
Gene: ENSMUSG00000025877
AA Change: M823V

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.7e-76 PFAM
Pfam:Hexokinase_2 234 473 1.9e-87 PFAM
Pfam:Hexokinase_1 475 674 2.2e-77 PFAM
Pfam:Hexokinase_2 676 915 2.3e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109994
SMART Domains Protein: ENSMUSP00000105621
Gene: ENSMUSG00000025876

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 294 1.98e-8 SMART
transmembrane domain 305 327 N/A INTRINSIC
ZU5 439 542 3.68e-58 SMART
DEATH 749 840 5.86e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123097
AA Change: M778V

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116717
Gene: ENSMUSG00000025877
AA Change: M778V

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.3e-77 PFAM
Pfam:Hexokinase_2 234 457 6e-74 PFAM
Pfam:Hexokinase_1 430 629 3e-78 PFAM
Pfam:Hexokinase_2 631 870 1e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126234
AA Change: M823V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000123233
Gene: ENSMUSG00000025877
AA Change: M823V

DomainStartEndE-ValueType
Pfam:Hexokinase_1 31 230 2.4e-63 PFAM
Pfam:Hexokinase_2 236 470 2.9e-62 PFAM
Pfam:Hexokinase_1 480 673 2e-69 PFAM
Pfam:Hexokinase_2 678 912 1.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132309
SMART Domains Protein: ENSMUSP00000117254
Gene: ENSMUSG00000025877

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 164 4.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137967
SMART Domains Protein: ENSMUSP00000115531
Gene: ENSMUSG00000025876

DomainStartEndE-ValueType
PDB:3G5B|A 1 118 6e-36 PDB
Blast:DEATH 80 119 9e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142906
Predicted Effect probably benign
Transcript: ENSMUST00000153665
AA Change: M768V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115227
Gene: ENSMUSG00000025877
AA Change: M768V

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 177 8.5e-70 PFAM
Pfam:Hexokinase_2 179 418 9.4e-88 PFAM
Pfam:Hexokinase_1 420 619 1.2e-77 PFAM
Pfam:Hexokinase_2 621 860 1.1e-103 PFAM
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 3. Similar to hexokinases 1 and 2, this allosteric enzyme is inhibited by its product glucose-6-phosphate. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,304,360 C1327R probably damaging Het
Adcy7 A G 8: 88,322,980 T704A probably benign Het
Adgra3 A T 5: 49,999,145 Y414* probably null Het
Adgrf1 T C 17: 43,295,209 S75P probably benign Het
Akirin1 A G 4: 123,750,163 M1T probably null Het
Antxr1 C A 6: 87,287,000 probably null Het
Arid1b A T 17: 5,336,682 Y1470F probably benign Het
Baiap3 T C 17: 25,246,334 D649G probably damaging Het
BC067074 G A 13: 113,318,619 V400M possibly damaging Het
Cabin1 A G 10: 75,739,366 V615A probably benign Het
Cntnap1 G A 11: 101,184,636 R880Q probably benign Het
Col28a1 T C 6: 8,013,140 T971A probably benign Het
Coro7 A T 16: 4,679,550 probably null Het
Defb19 T G 2: 152,576,267 probably null Het
Dnah17 T C 11: 118,055,889 D3045G probably benign Het
Dock4 A T 12: 40,733,351 probably null Het
Egln3 A G 12: 54,181,690 V210A probably damaging Het
Epb41l4a T C 18: 33,854,335 S330G probably benign Het
Epha7 G A 4: 28,821,521 E229K probably damaging Het
Fam71a C T 1: 191,162,722 E575K probably damaging Het
Fam71e1 C T 7: 44,500,295 R147W probably damaging Het
Fam71e2 T C 7: 4,753,595 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Gm29587 G A 12: 74,222,535 probably null Het
Gxylt2 T A 6: 100,804,594 L410Q probably damaging Het
H2-M10.3 C A 17: 36,368,395 C6F probably benign Het
Hecw1 G T 13: 14,346,062 Q197K probably benign Het
Hydin A G 8: 110,599,031 T4691A probably benign Het
Larp1 A G 11: 58,041,605 E204G possibly damaging Het
Lrp12 A C 15: 39,872,380 W738G probably damaging Het
Mdga2 A T 12: 66,630,053 D488E probably damaging Het
Mrc1 G C 2: 14,257,071 W290C probably damaging Het
Nhp2 T C 11: 51,620,085 V55A probably benign Het
Nrm T C 17: 35,861,505 S41P possibly damaging Het
Olfr1116 T A 2: 87,269,267 I141N possibly damaging Het
Olfr58 A G 9: 19,783,562 Y143C probably benign Het
Olfr741 T C 14: 50,486,220 L254P probably damaging Het
Osbpl7 C T 11: 97,050,716 P22S probably benign Het
Pebp1 A T 5: 117,284,105 L124Q probably benign Het
Pfkp G T 13: 6,597,969 H524N probably benign Het
Pnmt G A 11: 98,387,768 D187N probably damaging Het
Ppl A T 16: 5,102,581 I355K possibly damaging Het
Prom1 A T 5: 44,001,793 Y836N probably damaging Het
Rubcnl T C 14: 75,031,970 S23P probably benign Het
Sap130 T A 18: 31,680,486 I532N probably damaging Het
Serpina1e A T 12: 103,946,836 probably null Het
Skiv2l2 A T 13: 112,891,290 S679T probably benign Het
Slc12a3 T G 8: 94,330,472 S124R probably benign Het
Slc24a5 A G 2: 125,085,731 T317A probably benign Het
Smarcad1 T C 6: 65,073,248 S284P possibly damaging Het
Spag9 C G 11: 94,112,092 R724G probably damaging Het
Speg T C 1: 75,418,459 probably null Het
Steap3 A G 1: 120,241,641 Y271H probably damaging Het
Syne2 C T 12: 75,878,384 Q44* probably null Het
Tas2r114 A T 6: 131,689,481 C195S possibly damaging Het
Tcl1b4 T C 12: 105,202,507 M10T possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Vmn2r60 C A 7: 42,194,962 A583D probably benign Het
Wdhd1 T C 14: 47,263,580 Q455R possibly damaging Het
Wdr17 A G 8: 54,632,311 probably null Het
Xbp1 T C 11: 5,524,798 L233P probably benign Het
Zbtb17 A G 4: 141,464,441 E288G probably benign Het
Other mutations in Hk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Hk3 APN 13 55014426 critical splice donor site probably null
IGL01314:Hk3 APN 13 55007063 splice site probably benign
IGL02043:Hk3 APN 13 55015095 missense probably damaging 1.00
IGL02197:Hk3 APN 13 55014468 missense probably damaging 1.00
IGL02619:Hk3 APN 13 55014294 missense probably damaging 1.00
R0454:Hk3 UTSW 13 55008705 missense probably damaging 1.00
R0518:Hk3 UTSW 13 55014426 critical splice donor site probably null
R0521:Hk3 UTSW 13 55014426 critical splice donor site probably null
R0709:Hk3 UTSW 13 55014730 missense probably damaging 1.00
R1386:Hk3 UTSW 13 55007030 intron probably null
R1567:Hk3 UTSW 13 55006605 missense probably damaging 1.00
R1647:Hk3 UTSW 13 55014461 missense probably damaging 1.00
R1648:Hk3 UTSW 13 55014461 missense probably damaging 1.00
R1663:Hk3 UTSW 13 55006575 missense probably benign 0.00
R1936:Hk3 UTSW 13 55011391 missense probably damaging 0.98
R1940:Hk3 UTSW 13 55011391 missense probably damaging 0.98
R1966:Hk3 UTSW 13 55014455 missense probably damaging 1.00
R2345:Hk3 UTSW 13 55008993 missense probably damaging 1.00
R4838:Hk3 UTSW 13 55006418 missense probably damaging 1.00
R4852:Hk3 UTSW 13 55012596 missense probably damaging 0.99
R4883:Hk3 UTSW 13 55010922 missense probably benign 0.04
R4888:Hk3 UTSW 13 55006592 missense probably damaging 1.00
R5100:Hk3 UTSW 13 55009030 missense probably damaging 1.00
R5253:Hk3 UTSW 13 55011011 missense probably damaging 1.00
R5328:Hk3 UTSW 13 55013493 missense probably benign 0.00
R5441:Hk3 UTSW 13 55015056 missense probably damaging 1.00
R5493:Hk3 UTSW 13 55011171 missense probably damaging 1.00
R5557:Hk3 UTSW 13 55012075 nonsense probably null
R5575:Hk3 UTSW 13 55014770 missense probably damaging 0.99
R5578:Hk3 UTSW 13 55012181 missense probably damaging 1.00
R5686:Hk3 UTSW 13 55006813 missense probably damaging 1.00
R5872:Hk3 UTSW 13 55010804 missense probably damaging 1.00
R6038:Hk3 UTSW 13 55006560 missense probably benign 0.13
R6314:Hk3 UTSW 13 55013580 missense probably benign 0.02
R6315:Hk3 UTSW 13 55011157 missense probably benign 0.03
R6797:Hk3 UTSW 13 55010831 splice site probably null
R6827:Hk3 UTSW 13 55011352 missense probably damaging 0.98
R6860:Hk3 UTSW 13 55014465 missense probably damaging 0.98
R7082:Hk3 UTSW 13 55006897 missense probably benign 0.40
R7227:Hk3 UTSW 13 55012240 missense probably benign 0.00
X0003:Hk3 UTSW 13 55007136 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAACCAAAGCTGCGCCTTTG -3'
(R):5'- GACCACTCTGGAGGATGAAGTG -3'

Sequencing Primer
(F):5'- TCCTCCGACTGCAAAAAGGTG -3'
(R):5'- CTGGAGGATGAAGTGGGGGAAAC -3'
Posted On2017-08-16