Incidental Mutation 'R6038:Epb41l4a'
ID486717
Institutional Source Beutler Lab
Gene Symbol Epb41l4a
Ensembl Gene ENSMUSG00000024376
Gene Nameerythrocyte membrane protein band 4.1 like 4a
SynonymsNBL4, Epb4.1l4a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6038 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location33796327-34007206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33854335 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 330 (S330G)
Ref Sequence ENSEMBL: ENSMUSP00000025234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025234]
Predicted Effect probably benign
Transcript: ENSMUST00000025234
AA Change: S330G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025234
Gene: ENSMUSG00000024376
AA Change: S330G

DomainStartEndE-ValueType
B41 7 211 3.32e-78 SMART
FERM_C 215 303 1.48e-28 SMART
FA 310 357 2.25e-10 SMART
low complexity region 468 494 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 589 606 N/A INTRINSIC
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the band 4.1 protein superfamily. Members of this superfamily are thought to play an important role in regulating interactions between the cytoskeleton and plasma membrane, and contain an amino terminal conserved domain that binds glycophorin C. This gene product is thought to be involved in the beta-catenin signaling pathway. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,304,360 C1327R probably damaging Het
Adcy7 A G 8: 88,322,980 T704A probably benign Het
Adgra3 A T 5: 49,999,145 Y414* probably null Het
Adgrf1 T C 17: 43,295,209 S75P probably benign Het
Akirin1 A G 4: 123,750,163 M1T probably null Het
Antxr1 C A 6: 87,287,000 probably null Het
Arid1b A T 17: 5,336,682 Y1470F probably benign Het
Baiap3 T C 17: 25,246,334 D649G probably damaging Het
BC067074 G A 13: 113,318,619 V400M possibly damaging Het
Cabin1 A G 10: 75,739,366 V615A probably benign Het
Cntnap1 G A 11: 101,184,636 R880Q probably benign Het
Col28a1 T C 6: 8,013,140 T971A probably benign Het
Coro7 A T 16: 4,679,550 probably null Het
Defb19 T G 2: 152,576,267 probably null Het
Dnah17 T C 11: 118,055,889 D3045G probably benign Het
Dock4 A T 12: 40,733,351 probably null Het
Egln3 A G 12: 54,181,690 V210A probably damaging Het
Epha7 G A 4: 28,821,521 E229K probably damaging Het
Fam71a C T 1: 191,162,722 E575K probably damaging Het
Fam71e1 C T 7: 44,500,295 R147W probably damaging Het
Fam71e2 T C 7: 4,753,595 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Gm29587 G A 12: 74,222,535 probably null Het
Gxylt2 T A 6: 100,804,594 L410Q probably damaging Het
H2-M10.3 C A 17: 36,368,395 C6F probably benign Het
Hecw1 G T 13: 14,346,062 Q197K probably benign Het
Hk3 T C 13: 55,006,560 M778V probably benign Het
Hydin A G 8: 110,599,031 T4691A probably benign Het
Larp1 A G 11: 58,041,605 E204G possibly damaging Het
Lrp12 A C 15: 39,872,380 W738G probably damaging Het
Mdga2 A T 12: 66,630,053 D488E probably damaging Het
Mrc1 G C 2: 14,257,071 W290C probably damaging Het
Nhp2 T C 11: 51,620,085 V55A probably benign Het
Nrm T C 17: 35,861,505 S41P possibly damaging Het
Olfr1116 T A 2: 87,269,267 I141N possibly damaging Het
Olfr58 A G 9: 19,783,562 Y143C probably benign Het
Olfr741 T C 14: 50,486,220 L254P probably damaging Het
Osbpl7 C T 11: 97,050,716 P22S probably benign Het
Pebp1 A T 5: 117,284,105 L124Q probably benign Het
Pfkp G T 13: 6,597,969 H524N probably benign Het
Pnmt G A 11: 98,387,768 D187N probably damaging Het
Ppl A T 16: 5,102,581 I355K possibly damaging Het
Prom1 A T 5: 44,001,793 Y836N probably damaging Het
Rubcnl T C 14: 75,031,970 S23P probably benign Het
Sap130 T A 18: 31,680,486 I532N probably damaging Het
Serpina1e A T 12: 103,946,836 probably null Het
Skiv2l2 A T 13: 112,891,290 S679T probably benign Het
Slc12a3 T G 8: 94,330,472 S124R probably benign Het
Slc24a5 A G 2: 125,085,731 T317A probably benign Het
Smarcad1 T C 6: 65,073,248 S284P possibly damaging Het
Spag9 C G 11: 94,112,092 R724G probably damaging Het
Speg T C 1: 75,418,459 probably null Het
Steap3 A G 1: 120,241,641 Y271H probably damaging Het
Syne2 C T 12: 75,878,384 Q44* probably null Het
Tas2r114 A T 6: 131,689,481 C195S possibly damaging Het
Tcl1b4 T C 12: 105,202,507 M10T possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Vmn2r60 C A 7: 42,194,962 A583D probably benign Het
Wdhd1 T C 14: 47,263,580 Q455R possibly damaging Het
Wdr17 A G 8: 54,632,311 probably null Het
Xbp1 T C 11: 5,524,798 L233P probably benign Het
Zbtb17 A G 4: 141,464,441 E288G probably benign Het
Other mutations in Epb41l4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Epb41l4a APN 18 33801625 missense possibly damaging 0.95
IGL02942:Epb41l4a APN 18 33874201 missense probably damaging 1.00
IGL03051:Epb41l4a APN 18 33874772 missense probably damaging 1.00
IGL03236:Epb41l4a APN 18 33810219 missense probably damaging 0.98
PIT1430001:Epb41l4a UTSW 18 33797347 missense probably damaging 1.00
R0147:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0148:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0437:Epb41l4a UTSW 18 33880273 missense probably damaging 1.00
R1511:Epb41l4a UTSW 18 33832664 missense probably benign 0.01
R1666:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1668:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1750:Epb41l4a UTSW 18 33828208 nonsense probably null
R2022:Epb41l4a UTSW 18 33921840 missense probably benign 0.00
R2047:Epb41l4a UTSW 18 33828206 missense probably benign 0.00
R2133:Epb41l4a UTSW 18 33874195 missense probably damaging 1.00
R3741:Epb41l4a UTSW 18 33828102 critical splice donor site probably null
R4393:Epb41l4a UTSW 18 33891420 splice site probably null
R4700:Epb41l4a UTSW 18 33802507 splice site probably null
R4878:Epb41l4a UTSW 18 33798572 missense probably damaging 1.00
R5226:Epb41l4a UTSW 18 33810313 missense probably damaging 1.00
R5284:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R5584:Epb41l4a UTSW 18 33854271 missense probably damaging 1.00
R5945:Epb41l4a UTSW 18 33828730 missense possibly damaging 0.89
R6005:Epb41l4a UTSW 18 33828143 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6177:Epb41l4a UTSW 18 33798815 splice site probably null
R6188:Epb41l4a UTSW 18 33832665 missense probably benign
R6314:Epb41l4a UTSW 18 33874155 missense probably damaging 1.00
R6552:Epb41l4a UTSW 18 33878979 missense probably damaging 1.00
X0028:Epb41l4a UTSW 18 33802537 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TTCAGTCACCACCTGAACGC -3'
(R):5'- AGTTTAGTGCCGCCTTCTTG -3'

Sequencing Primer
(F):5'- GTCACCACCTGAACGCACTTC -3'
(R):5'- TGGCCATCTGGTTCTACT -3'
Posted On2017-08-16