Incidental Mutation 'R6039:Psg28'
ID486742
Institutional Source Beutler Lab
Gene Symbol Psg28
Ensembl Gene ENSMUSG00000030373
Gene Namepregnancy-specific glycoprotein 28
Synonyms
MMRRC Submission 043259-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6039 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location18422536-18432041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18426182 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 363 (D363G)
Ref Sequence ENSEMBL: ENSMUSP00000019291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019291]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019291
AA Change: D363G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019291
Gene: ENSMUSG00000030373
AA Change: D363G

DomainStartEndE-ValueType
IG 40 138 1.84e-2 SMART
IG 157 258 1.67e0 SMART
IG 277 376 1.65e-4 SMART
IGc2 394 458 8.31e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 C T 6: 92,908,546 R416Q possibly damaging Het
Adgre1 C A 17: 57,406,859 D181E probably benign Het
Arhgap24 T C 5: 102,880,786 S183P probably damaging Het
Asb1 T C 1: 91,547,026 L90P probably damaging Het
Bmp3 T C 5: 98,872,350 F211L probably benign Het
C8a A G 4: 104,845,942 I306T probably benign Het
Cdkn3 G A 14: 46,769,916 G177R probably damaging Het
Chat A G 14: 32,449,027 S172P probably damaging Het
Chd5 CAAGAAGAAGAAGAAGAA CAAGAAGAAGAAGAA 4: 152,353,621 probably benign Het
Cyp4a12a T C 4: 115,327,223 I265T probably damaging Het
Dlst T A 12: 85,118,890 probably null Het
Dnmt1 A T 9: 20,926,420 probably benign Het
Fbn1 C T 2: 125,363,880 E1066K probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fstl1 T A 16: 37,821,176 S105T probably benign Het
Gm19410 C G 8: 35,809,364 A1725G probably benign Het
Hspb7 A G 4: 141,423,904 N119S probably damaging Het
Il20 T A 1: 130,910,741 D73V possibly damaging Het
Insrr T C 3: 87,809,301 I612T possibly damaging Het
Kcnma1 T C 14: 23,309,037 Y1107C probably benign Het
Klhl32 A G 4: 24,792,615 probably null Het
Krt77 C A 15: 101,860,916 R470L possibly damaging Het
Muc1 T C 3: 89,232,029 Y579H probably damaging Het
Myof T C 19: 37,977,684 D396G probably damaging Het
Myom1 T G 17: 71,110,751 D1316E probably damaging Het
Nbea T C 3: 56,005,117 E1083G probably benign Het
Nek9 G A 12: 85,313,085 A531V probably benign Het
Nlrp12 A T 7: 3,241,372 I170N possibly damaging Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Ovch2 G A 7: 107,789,111 L421F probably damaging Het
Paqr4 T C 17: 23,739,994 D11G probably damaging Het
Parp8 A G 13: 116,877,598 S561P probably damaging Het
Pcgf5 T A 19: 36,442,906 F179L probably damaging Het
Pde4d A T 13: 109,948,342 Q422L probably damaging Het
Pigs T A 11: 78,341,825 V495E probably damaging Het
Polh C T 17: 46,188,033 R252H probably benign Het
Ptgir A T 7: 16,906,890 I36F possibly damaging Het
Ptprr G A 10: 116,236,763 probably null Het
Rax C T 18: 65,935,347 G229D unknown Het
Secisbp2l T A 2: 125,773,216 H163L probably benign Het
Sf3a2 A G 10: 80,801,463 Y45C probably damaging Het
Sgo2a C T 1: 58,016,616 T653I possibly damaging Het
Slc38a9 A T 13: 112,669,697 I26F probably damaging Het
Slc5a8 A G 10: 88,886,574 I90V probably benign Het
Slx4 G A 16: 3,986,047 H968Y possibly damaging Het
Stam2 T C 2: 52,709,599 T233A probably benign Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Trav4-2 G A 14: 53,418,409 V8M possibly damaging Het
Ttll5 T A 12: 85,831,955 H45Q probably damaging Het
Ttn C T 2: 76,884,418 probably benign Het
Ush2a T A 1: 188,319,020 F234L possibly damaging Het
Vmn2r74 T A 7: 85,958,318 probably null Het
Wdr6 CTG C 9: 108,573,795 probably null Het
Zfp644 A G 5: 106,635,425 S997P possibly damaging Het
Zfp853 G A 5: 143,288,774 Q364* probably null Het
Other mutations in Psg28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Psg28 APN 7 18427891 missense probably damaging 1.00
IGL01118:Psg28 APN 7 18428092 missense probably damaging 1.00
IGL01606:Psg28 APN 7 18430371 missense probably benign 0.01
R0276:Psg28 UTSW 7 18430396 missense probably benign 0.00
R0391:Psg28 UTSW 7 18426173 missense probably benign 0.02
R0713:Psg28 UTSW 7 18423074 missense possibly damaging 0.61
R1454:Psg28 UTSW 7 18427964 missense possibly damaging 0.50
R1725:Psg28 UTSW 7 18428011 missense possibly damaging 0.67
R2176:Psg28 UTSW 7 18427879 missense probably damaging 1.00
R3154:Psg28 UTSW 7 18426423 missense possibly damaging 0.91
R4520:Psg28 UTSW 7 18422901 missense probably benign 0.00
R5010:Psg28 UTSW 7 18427891 missense probably damaging 1.00
R5529:Psg28 UTSW 7 18430448 missense probably benign 0.15
R5772:Psg28 UTSW 7 18430715 missense probably damaging 1.00
R6039:Psg28 UTSW 7 18426182 missense possibly damaging 0.82
R6046:Psg28 UTSW 7 18426380 missense probably damaging 1.00
R6275:Psg28 UTSW 7 18430440 missense probably damaging 1.00
R6586:Psg28 UTSW 7 18430544 missense probably damaging 0.99
R6928:Psg28 UTSW 7 18423078 missense possibly damaging 0.80
R7197:Psg28 UTSW 7 18430584 missense probably damaging 1.00
R7237:Psg28 UTSW 7 18427844 missense possibly damaging 0.65
X0020:Psg28 UTSW 7 18427939 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGGTACAGCCCATGTGTGC -3'
(R):5'- GGTCTGCAAACCTTTTCCTGG -3'

Sequencing Primer
(F):5'- ATGTGTGCCCTGCAGCAAG -3'
(R):5'- CTGCAAACCTTTTCCTGGTACAAAGG -3'
Posted On2017-08-16