Incidental Mutation 'R6039:Nek9'
ID486754
Institutional Source Beutler Lab
Gene Symbol Nek9
Ensembl Gene ENSMUSG00000034290
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 9
SynonymsC130021H08Rik
MMRRC Submission 043259-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R6039 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location85299514-85339362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85313085 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 531 (A531V)
Ref Sequence ENSEMBL: ENSMUSP00000049056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040992]
Predicted Effect probably benign
Transcript: ENSMUST00000040992
AA Change: A531V

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000049056
Gene: ENSMUSG00000034290
AA Change: A531V

DomainStartEndE-ValueType
low complexity region 19 49 N/A INTRINSIC
S_TKc 52 308 1.07e-73 SMART
Pfam:RCC1 389 441 1.2e-9 PFAM
Pfam:RCC1_2 428 457 1.5e-8 PFAM
Pfam:RCC1 444 495 3.6e-13 PFAM
Pfam:RCC1_2 482 511 3.6e-11 PFAM
Pfam:RCC1 499 547 7.6e-14 PFAM
Pfam:RCC1 615 665 4.2e-8 PFAM
Pfam:RCC1_2 652 681 4.4e-7 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 910 927 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein is activated in mitosis and, in turn, activates other family members during mitosis. This protein also mediates cellular processes that are essential for interphase progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 C T 6: 92,908,546 R416Q possibly damaging Het
Adgre1 C A 17: 57,406,859 D181E probably benign Het
Arhgap24 T C 5: 102,880,786 S183P probably damaging Het
Asb1 T C 1: 91,547,026 L90P probably damaging Het
Bmp3 T C 5: 98,872,350 F211L probably benign Het
C8a A G 4: 104,845,942 I306T probably benign Het
Cdkn3 G A 14: 46,769,916 G177R probably damaging Het
Chat A G 14: 32,449,027 S172P probably damaging Het
Chd5 CAAGAAGAAGAAGAAGAA CAAGAAGAAGAAGAA 4: 152,353,621 probably benign Het
Cyp4a12a T C 4: 115,327,223 I265T probably damaging Het
Dlst T A 12: 85,118,890 probably null Het
Dnmt1 A T 9: 20,926,420 probably benign Het
Fbn1 C T 2: 125,363,880 E1066K probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fstl1 T A 16: 37,821,176 S105T probably benign Het
Gm19410 C G 8: 35,809,364 A1725G probably benign Het
Hspb7 A G 4: 141,423,904 N119S probably damaging Het
Il20 T A 1: 130,910,741 D73V possibly damaging Het
Insrr T C 3: 87,809,301 I612T possibly damaging Het
Kcnma1 T C 14: 23,309,037 Y1107C probably benign Het
Klhl32 A G 4: 24,792,615 probably null Het
Krt77 C A 15: 101,860,916 R470L possibly damaging Het
Muc1 T C 3: 89,232,029 Y579H probably damaging Het
Myof T C 19: 37,977,684 D396G probably damaging Het
Myom1 T G 17: 71,110,751 D1316E probably damaging Het
Nbea T C 3: 56,005,117 E1083G probably benign Het
Nlrp12 A T 7: 3,241,372 I170N possibly damaging Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Ovch2 G A 7: 107,789,111 L421F probably damaging Het
Paqr4 T C 17: 23,739,994 D11G probably damaging Het
Parp8 A G 13: 116,877,598 S561P probably damaging Het
Pcgf5 T A 19: 36,442,906 F179L probably damaging Het
Pde4d A T 13: 109,948,342 Q422L probably damaging Het
Pigs T A 11: 78,341,825 V495E probably damaging Het
Polh C T 17: 46,188,033 R252H probably benign Het
Psg28 T C 7: 18,426,182 D363G possibly damaging Het
Ptgir A T 7: 16,906,890 I36F possibly damaging Het
Ptprr G A 10: 116,236,763 probably null Het
Rax C T 18: 65,935,347 G229D unknown Het
Secisbp2l T A 2: 125,773,216 H163L probably benign Het
Sf3a2 A G 10: 80,801,463 Y45C probably damaging Het
Sgo2a C T 1: 58,016,616 T653I possibly damaging Het
Slc38a9 A T 13: 112,669,697 I26F probably damaging Het
Slc5a8 A G 10: 88,886,574 I90V probably benign Het
Slx4 G A 16: 3,986,047 H968Y possibly damaging Het
Stam2 T C 2: 52,709,599 T233A probably benign Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Trav4-2 G A 14: 53,418,409 V8M possibly damaging Het
Ttll5 T A 12: 85,831,955 H45Q probably damaging Het
Ttn C T 2: 76,884,418 probably benign Het
Ush2a T A 1: 188,319,020 F234L possibly damaging Het
Vmn2r74 T A 7: 85,958,318 probably null Het
Wdr6 CTG C 9: 108,573,795 probably null Het
Zfp644 A G 5: 106,635,425 S997P possibly damaging Het
Zfp853 G A 5: 143,288,774 Q364* probably null Het
Other mutations in Nek9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Nek9 APN 12 85314587 missense probably benign 0.23
IGL01595:Nek9 APN 12 85314420 missense probably damaging 1.00
IGL01603:Nek9 APN 12 85305605 missense probably damaging 1.00
IGL01893:Nek9 APN 12 85336400 missense probably damaging 1.00
IGL02017:Nek9 APN 12 85329923 missense probably damaging 1.00
IGL02197:Nek9 APN 12 85307930 missense probably null
IGL02207:Nek9 APN 12 85303483 nonsense probably null
IGL02749:Nek9 APN 12 85305507 missense probably benign 0.02
IGL02756:Nek9 APN 12 85311336 critical splice donor site probably null
IGL03343:Nek9 APN 12 85303609 missense probably damaging 1.00
R0048:Nek9 UTSW 12 85301899 missense probably benign 0.17
R0331:Nek9 UTSW 12 85327375 splice site probably benign
R0499:Nek9 UTSW 12 85301883 missense probably benign 0.09
R1484:Nek9 UTSW 12 85301848 missense probably damaging 1.00
R1760:Nek9 UTSW 12 85305590 missense possibly damaging 0.71
R1760:Nek9 UTSW 12 85310410 missense probably benign 0.00
R1883:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1884:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1999:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2046:Nek9 UTSW 12 85320707 splice site probably benign
R2096:Nek9 UTSW 12 85314548 missense probably benign 0.00
R2150:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2368:Nek9 UTSW 12 85329887 missense possibly damaging 0.89
R2570:Nek9 UTSW 12 85332546 nonsense probably null
R4381:Nek9 UTSW 12 85329858 missense probably damaging 1.00
R4570:Nek9 UTSW 12 85320734 missense probably damaging 1.00
R4661:Nek9 UTSW 12 85320892 missense possibly damaging 0.78
R4669:Nek9 UTSW 12 85314204 missense probably benign 0.00
R4993:Nek9 UTSW 12 85310420 missense probably damaging 1.00
R5071:Nek9 UTSW 12 85327459 missense possibly damaging 0.70
R5090:Nek9 UTSW 12 85329842 critical splice donor site probably null
R5248:Nek9 UTSW 12 85308977 missense probably damaging 1.00
R5521:Nek9 UTSW 12 85327445 missense probably benign 0.09
R5734:Nek9 UTSW 12 85303515 missense probably benign
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6269:Nek9 UTSW 12 85332329 intron probably null
R6353:Nek9 UTSW 12 85301829 missense probably damaging 0.96
R6406:Nek9 UTSW 12 85339172 missense probably damaging 0.97
R6744:Nek9 UTSW 12 85329929 missense probably benign 0.09
R6922:Nek9 UTSW 12 85303537 missense probably damaging 1.00
X0052:Nek9 UTSW 12 85322027 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCAACATGGTTAAAACCTCAAG -3'
(R):5'- AGTCTTCCCTCTACAGAAGCC -3'

Sequencing Primer
(F):5'- TCAAGGGCCACTCACTTCATGG -3'
(R):5'- TCTCCAAAGGTGTAGGAGCCATTC -3'
Posted On2017-08-16