Incidental Mutation 'R0523:Dpyd'
ID48684
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Namedihydropyrimidine dehydrogenase
SynonymsDPD, E330028L06Rik
MMRRC Submission 038716-MU
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R0523 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location118562129-119432918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118899203 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 332 (R332K)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
Predicted Effect probably benign
Transcript: ENSMUST00000039177
AA Change: R332K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: R332K

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129148
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,644,629 M1K probably null Het
2410089E03Rik T A 15: 8,194,386 Y878N probably damaging Het
Actl9 T A 17: 33,433,349 W128R probably damaging Het
Aggf1 T C 13: 95,356,416 I562V probably damaging Het
Ano3 T A 2: 110,884,855 E79D probably benign Het
Apobec1 T A 6: 122,581,545 I84F probably damaging Het
Atp6v1b2 T C 8: 69,109,985 F458L possibly damaging Het
BC048546 T C 6: 128,558,326 D807G possibly damaging Het
BC051142 G T 17: 34,445,499 probably null Het
Bco2 A T 9: 50,534,626 V490E probably damaging Het
Catsperg1 G A 7: 29,185,190 silent Het
Cdc37 T C 9: 21,142,996 K111R probably damaging Het
Cfap54 T C 10: 92,908,883 T2233A unknown Het
Cpox T A 16: 58,675,245 C308* probably null Het
Ctnna3 T G 10: 64,675,909 M626R probably damaging Het
Cyp2c68 T C 19: 39,739,429 E93G probably benign Het
Cyp2s1 G A 7: 25,806,050 R330W probably damaging Het
Diaph1 C T 18: 37,856,500 V860I possibly damaging Het
Dicer1 A G 12: 104,702,491 S1311P probably damaging Het
E130308A19Rik G A 4: 59,719,716 R416H probably damaging Het
Eef1d T C 15: 75,903,156 D218G possibly damaging Het
Eif2ak1 T C 5: 143,882,166 V215A probably damaging Het
Eif2ak4 T C 2: 118,442,096 probably null Het
Fam71e2 A G 7: 4,759,393 S246P possibly damaging Het
Fcrl5 T C 3: 87,457,792 S583P possibly damaging Het
Grid2ip C A 5: 143,373,043 Q29K possibly damaging Het
Htr1f A T 16: 64,925,899 N343K probably damaging Het
Hvcn1 T C 5: 122,216,365 probably null Het
Igf2r T C 17: 12,692,064 I1956V probably benign Het
Impdh2 A T 9: 108,561,819 T96S probably benign Het
Impdh2 C T 9: 108,561,820 T96I possibly damaging Het
Lactb C G 9: 66,970,692 G285A probably benign Het
Lrrc43 T C 5: 123,501,242 S445P probably damaging Het
Maats1 G A 16: 38,328,374 P231S probably damaging Het
Mapk12 T G 15: 89,135,645 M120L probably benign Het
Mroh8 C G 2: 157,224,036 A669P probably damaging Het
Mrpl38 A C 11: 116,132,018 H373Q probably benign Het
Myocd A G 11: 65,180,902 V740A probably damaging Het
Naprt A G 15: 75,892,465 F300S probably damaging Het
Ncam2 T C 16: 81,461,643 I271T probably damaging Het
Nek4 A G 14: 30,980,038 T637A probably benign Het
Notch2 C T 3: 98,070,970 T89I probably benign Het
Notch2 G A 3: 98,111,598 R692H probably benign Het
Nt5c3 A T 6: 56,883,681 N296K probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Oas3 T C 5: 120,766,144 Q555R unknown Het
Olfr1013 T A 2: 85,769,929 S43T probably benign Het
Olfr494 A T 7: 108,368,231 H247L probably damaging Het
Olfr699 A G 7: 106,790,326 V225A probably damaging Het
P3h1 C A 4: 119,241,530 Q410K probably benign Het
Pax3 A G 1: 78,195,441 V44A possibly damaging Het
Pde1c T A 6: 56,174,941 L252F probably damaging Het
Pdzd7 T A 19: 45,036,090 T497S probably benign Het
Piezo2 T C 18: 63,022,481 T253A probably damaging Het
Pipox T C 11: 77,892,139 E79G probably damaging Het
Pole G T 5: 110,303,593 M829I probably damaging Het
Ppp1r12c A T 7: 4,489,772 L235Q probably damaging Het
Psme2b T G 11: 48,945,782 T113P probably damaging Het
Ptprq A G 10: 107,580,220 I1739T possibly damaging Het
Qser1 T C 2: 104,789,676 T174A probably damaging Het
Rcor3 T G 1: 192,130,436 D81A probably damaging Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rnf11 T C 4: 109,456,922 D90G probably benign Het
Sh3tc1 GCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCC 5: 35,724,066 probably benign Het
Smad2 T A 18: 76,262,552 S21T probably benign Het
Smc4 A G 3: 69,025,888 D639G probably damaging Het
Smtn A T 11: 3,524,664 S716T possibly damaging Het
Smug1 G T 15: 103,155,709 Q262K probably benign Het
Sspo G T 6: 48,451,860 G403V probably benign Het
Tas2r131 A G 6: 132,957,451 F132L possibly damaging Het
Tgm3 T C 2: 130,044,662 probably null Het
Tigd2 C T 6: 59,210,373 T75M probably benign Het
Tnfrsf13b T C 11: 61,147,587 V232A probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim47 A G 11: 116,107,890 L301S probably damaging Het
Trim75 G A 8: 64,983,790 H3Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ttc29 G C 8: 78,276,837 L227F probably benign Het
Ttc39d G A 17: 80,216,457 D182N possibly damaging Het
Ttll10 T A 4: 156,045,361 R282* probably null Het
Ufsp2 T A 8: 45,996,743 D447E probably benign Het
Ugt2b37 T A 5: 87,251,832 L272F possibly damaging Het
Vps13b T C 15: 35,472,050 V833A probably benign Het
Zbbx T C 3: 75,081,858 T308A probably benign Het
Zfp933 G A 4: 147,826,462 Q226* probably null Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice acceptor site noncoding transcript
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site noncoding transcript
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site noncoding transcript
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site noncoding transcript
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site noncoding transcript
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCTGGAAAACTGCAAGATGCAA -3'
(R):5'- AGCTCTTTTAAAGTGCTCTGCTGCAA -3'

Sequencing Primer
(F):5'- CTGCAAGATGCAATTTTACAGTGC -3'
(R):5'- GCATATCAACAGTGTCATTGCC -3'
Posted OnJun 12, 2013