Incidental Mutation 'R5564:M1ap'
ID486843
Institutional Source Beutler Lab
Gene Symbol M1ap
Ensembl Gene ENSMUSG00000030041
Gene Namemeiosis 1 associated protein
SynonymsD6Mm5e
MMRRC Submission 043121-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5564 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location82946902-83030309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82981817 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 143 (I143N)
Ref Sequence ENSEMBL: ENSMUSP00000109613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113980]
Predicted Effect probably damaging
Transcript: ENSMUST00000113980
AA Change: I143N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109613
Gene: ENSMUSG00000030041
AA Change: I143N

DomainStartEndE-ValueType
low complexity region 151 163 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 482 500 N/A INTRINSIC
low complexity region 504 512 N/A INTRINSIC
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is likely to function in progression of meiosis. A similar protein in mouse plays a role in gametogenesis in both sexes. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility with oligospermia, globozooaspermiam decreased testies weight and size, degeneration of seminiferous tubules, male germ cell apoptosis and arrested male meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,934,581 L1598M probably benign Het
Adam4 T C 12: 81,419,574 T758A probably benign Het
B3galnt2 T C 13: 13,995,229 I424T probably damaging Het
Cacna1g T C 11: 94,430,486 Y1316C probably damaging Het
Cacna2d1 T C 5: 16,312,519 S388P probably damaging Het
Ccdc157 A G 11: 4,148,765 L247S probably damaging Het
Cdh8 A G 8: 99,030,866 I700T possibly damaging Het
Cdhr3 G T 12: 33,048,986 Y535* probably null Het
Clasp2 T C 9: 113,812,768 probably null Het
Col16a1 T A 4: 130,053,358 D165E probably damaging Het
Col9a1 A T 1: 24,195,355 probably benign Het
Cpa3 A T 3: 20,242,143 I10N possibly damaging Het
Cstf3 T A 2: 104,609,002 probably benign Het
Dnah3 C A 7: 119,971,466 probably null Het
E2f6 T C 12: 16,824,705 C263R probably benign Het
Eps8l2 C A 7: 141,356,621 Q288K possibly damaging Het
Fam193a T A 5: 34,420,855 V231D probably damaging Het
Gjc1 C T 11: 102,800,203 G325S probably benign Het
Gm5538 T C 3: 59,752,092 V322A probably benign Het
Gpatch8 T A 11: 102,538,285 E39D unknown Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Kansl3 G T 1: 36,345,964 H629N possibly damaging Het
Kcna10 C A 3: 107,194,229 H59N probably benign Het
Kitl A T 10: 100,080,024 E138D possibly damaging Het
Kpna2 T C 11: 106,990,745 K353R probably damaging Het
Macf1 A G 4: 123,526,745 S239P possibly damaging Het
Med13l T A 5: 118,742,040 S1066T probably damaging Het
Mettl23 G T 11: 116,849,039 E47* probably null Het
Olfr312 C T 11: 58,831,213 Q20* probably null Het
Olfr556 T C 7: 102,670,226 F102S probably damaging Het
Proca1 T A 11: 78,201,873 D48E possibly damaging Het
Rab34 T G 11: 78,191,632 V227G probably damaging Het
Rab7 A T 6: 88,013,650 L14Q probably damaging Het
Rasgef1c C T 11: 49,957,107 S23F probably benign Het
Rit1 A G 3: 88,726,150 probably benign Het
Scin T C 12: 40,124,569 T172A probably benign Het
Scmh1 C A 4: 120,468,378 N97K probably damaging Het
Skint6 T C 4: 112,988,965 E655G possibly damaging Het
Slc22a15 A G 3: 101,864,589 V243A probably benign Het
Smg1 A G 7: 118,189,819 probably benign Het
Smim7 C T 8: 72,571,023 G3R probably damaging Het
Snurf C T 7: 59,995,534 R44H possibly damaging Het
Snx13 G A 12: 35,124,472 A667T possibly damaging Het
Sowaha T G 11: 53,478,763 H382P probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmem259 G T 10: 79,978,608 probably null Het
Topbp1 A G 9: 103,334,078 T945A probably damaging Het
Tor1aip2 T C 1: 156,063,561 probably benign Het
Ube3b T C 5: 114,389,075 V118A probably damaging Het
Usp38 T C 8: 80,985,088 K773E probably damaging Het
Wnk1 G A 6: 119,948,891 probably benign Het
Zfp871 A G 17: 32,775,868 V111A possibly damaging Het
Other mutations in M1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:M1ap APN 6 82956665 missense probably damaging 1.00
IGL01511:M1ap APN 6 83028412 missense probably benign 0.00
IGL01803:M1ap APN 6 83005584 missense probably benign 0.01
IGL02243:M1ap APN 6 83026288 missense probably damaging 1.00
R1799:M1ap UTSW 6 83005510 nonsense probably null
R2073:M1ap UTSW 6 82981882 missense probably benign 0.05
R2074:M1ap UTSW 6 82981882 missense probably benign 0.05
R2355:M1ap UTSW 6 82956503 missense probably benign 0.00
R4063:M1ap UTSW 6 83003775 missense probably damaging 1.00
R5024:M1ap UTSW 6 83028358 unclassified probably benign
R5029:M1ap UTSW 6 83003832 missense probably damaging 1.00
R5740:M1ap UTSW 6 82981922 missense probably damaging 0.96
R5821:M1ap UTSW 6 82968102 missense probably benign 0.11
R5860:M1ap UTSW 6 83003814 missense probably damaging 1.00
R6190:M1ap UTSW 6 83003896 missense possibly damaging 0.60
R6773:M1ap UTSW 6 82968080 missense probably damaging 1.00
R7350:M1ap UTSW 6 82981949 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CACTGTACTGGAATGGACTTGTG -3'
(R):5'- CCATCATTGCTGGGTTCTTCAG -3'

Sequencing Primer
(F):5'- GTGGGTTTTCTGTCCCTCTAGAC -3'
(R):5'- TTCAGTAGGAGATGGTGAGTCTGAAC -3'
Posted On2017-08-28