Incidental Mutation 'PIT4142001:Dnajc13'
ID486942
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene NameDnaJ heat shock protein family (Hsp40) member C13
SynonymsLOC382100, D030002L11Rik, Rme8
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #PIT4142001 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location104151282-104262930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104238473 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 46 (T46A)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035170
AA Change: T46A

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: T46A

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186788
AA Change: T46A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: T46A

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189299
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (105/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Abcg5 T G 17: 84,673,594 Y107S possibly damaging Het
Abhd8 T C 8: 71,461,855 E43G probably damaging Het
Ap1b1 T G 11: 5,040,360 L872W probably damaging Het
Arid1b T A 17: 5,339,243 M1688K probably damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G C 10: 58,223,456 P492R probably damaging Het
AW822073 G A 10: 58,224,314 probably benign Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
Brca1 T C 11: 101,522,422 probably benign Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
C4b C T 17: 34,733,701 V1151I probably benign Het
Card6 T A 15: 5,098,631 Q1094H unknown Het
Cd22 C A 7: 30,877,799 V28F possibly damaging Het
Cdc42bpa A T 1: 180,031,560 N109I probably damaging Het
Ces2b T C 8: 104,836,810 Y390H probably damaging Het
Clca4a T C 3: 144,968,311 Y221C probably damaging Het
Cntnap5a G T 1: 115,684,956 probably benign Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dcc A T 18: 71,384,226 probably null Het
Dnaaf5 A G 5: 139,185,518 K812E possibly damaging Het
Duxf3 C A 10: 58,231,168 C503F probably damaging Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Duxf3 C A 10: 58,230,988 R563M probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Etfdh C T 3: 79,609,867 S345N probably damaging Het
Fat3 A G 9: 15,992,118 probably null Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gabra4 T C 5: 71,571,763 N558S probably damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 T C 9: 3,001,350 L142S probably benign Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Het
Gm10800 C A 2: 98,666,905 V123F probably benign Het
Gm10800 CAAGAAAACTGAAAATCA C 2: 98,667,016 probably null Het
Gm10801 A G 2: 98,662,303 R23G probably benign Het
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21663 C T 5: 25,938,769 R185H probably benign Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Gm7682 A C 5: 94,446,784 K168Q probably benign Het
Gpr107 T A 2: 31,167,071 D58E probably benign Het
Gstm7 AAC A 3: 107,931,483 probably null Het
Hc C T 2: 35,031,821 probably benign Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hnrnpa2b1 A T 6: 51,464,109 M327K probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Ifi206 A G 1: 173,481,164 V422A probably benign Het
Igf2bp3 A G 6: 49,117,383 V151A probably damaging Het
Ivl TTGC T 3: 92,572,301 probably benign Het
Kndc1 TC T 7: 139,923,776 probably null Het
Lig1 GC G 7: 13,305,924 probably null Het
Lrit1 A G 14: 37,062,041 Y442C probably damaging Het
Map3k21 C A 8: 125,937,308 P536H probably damaging Het
March10 T A 11: 105,390,520 Y313F probably benign Het
Mcm5 A G 8: 75,127,236 H706R probably benign Het
Mlycd T G 8: 119,410,460 I473S probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc4 C G 16: 32,755,676 probably benign Het
Muc4 T A 16: 32,755,684 probably benign Het
Myo5c T C 9: 75,283,948 V1088A probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Het
Ndufs1 A G 1: 63,159,748 probably benign Het
Olfr732 A G 14: 50,281,327 *309Q probably null Het
Pak2 A T 16: 32,023,112 Y443N probably damaging Het
Pik3r6 T C 11: 68,527,105 I73T probably damaging Het
Pla2g4c A G 7: 13,343,391 E286G probably benign Het
Plekhn1 G A 4: 156,224,940 R196* probably null Het
Prdm10 T A 9: 31,325,767 D145E probably benign Het
Ptgis T C 2: 167,206,830 Y422C probably damaging Het
Ralgapb A G 2: 158,430,422 E132G probably benign Het
Rasgrf1 G A 9: 89,915,573 R168H possibly damaging Het
Rpl5 T C 5: 107,907,183 probably benign Het
Ryr2 T C 13: 11,707,796 K2603E probably damaging Het
Sap130 T C 18: 31,667,011 probably null Het
Scn5a C A 9: 119,486,258 D1794Y probably damaging Het
Sec31a A T 5: 100,407,275 S29T probably damaging Het
Selplg T G 5: 113,819,628 K206Q probably benign Het
Sfmbt1 A T 14: 30,816,757 probably null Het
Sirpb1a A T 3: 15,411,198 F180I probably benign Het
Slc44a4 A G 17: 34,921,275 I67V probably damaging Het
Sp110 C T 1: 85,586,250 R262Q probably benign Het
Sp110 T C 1: 85,586,254 R261G probably benign Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Stab2 A T 10: 86,867,175 S1848R possibly damaging Het
Stat6 T C 10: 127,658,230 V642A possibly damaging Het
Tfam T C 10: 71,234,983 K63R possibly damaging Het
Trim2 T C 3: 84,190,857 N379S probably benign Het
Trp63 C T 16: 25,865,263 T300I probably damaging Het
Tymp C A 15: 89,376,345 W90L probably damaging Het
Ubr5 A G 15: 38,041,909 S148P probably damaging Het
Ugt1a10 TTCA T 1: 88,216,158 probably benign Het
Usp47 T C 7: 112,104,341 probably benign Het
Uvssa C T 5: 33,392,084 A363V probably benign Het
Vldlr T A 19: 27,234,869 D94E probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn1r67 T A 7: 10,446,950 M47K probably benign Het
Vmn1r87 A T 7: 13,132,185 H58Q probably benign Het
Vmn1r89 A G 7: 13,219,588 T84A probably benign Het
Vmn2r109 T C 17: 20,554,577 probably null Het
Xirp2 T C 2: 67,519,362 probably benign Het
Zbtb2 A G 10: 4,369,493 S178P probably benign Het
Zfp534 C T 4: 147,675,574 E213K probably benign Het
Zfp534 C A 4: 147,678,313 D21Y probably benign Het
Zfp804b C T 5: 6,769,422 V1214I probably damaging Het
Zfp82 G T 7: 30,057,276 T63K probably damaging Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCTAGAAAGCATGTGCCC -3'
(R):5'- ACCATTGAACTATTGATCAGCCAAC -3'

Sequencing Primer
(F):5'- GCGCTCGCTCTCACACAC -3'
(R):5'- GAAAGTGTATTCATTTTGTG -3'
Posted On2017-09-21