Incidental Mutation 'R6130:Wdr63'
ID487076
Institutional Source Beutler Lab
Gene Symbol Wdr63
Ensembl Gene ENSMUSG00000043020
Gene NameWD repeat domain 63
Synonyms4931433A13Rik
MMRRC Submission 044277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6130 (G1)
Quality Score193.009
Status Validated
Chromosome3
Chromosomal Location146040526-146108130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 146042804 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 852 (Y852D)
Ref Sequence ENSEMBL: ENSMUSP00000124475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160285]
Predicted Effect probably benign
Transcript: ENSMUST00000160285
AA Change: Y852D

PolyPhen 2 Score 0.245 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124475
Gene: ENSMUSG00000043020
AA Change: Y852D

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
low complexity region 133 150 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
Blast:WD40 321 367 6e-19 BLAST
low complexity region 375 383 N/A INTRINSIC
WD40 390 429 6.34e-2 SMART
WD40 470 527 1.15e-4 SMART
low complexity region 536 553 N/A INTRINSIC
WD40 693 732 1.07e1 SMART
WD40 737 776 1.1e2 SMART
coiled coil region 867 902 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196412
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abi3 T A 11: 95,837,095 E90V probably damaging Het
Adgrv1 A C 13: 81,427,745 V4834G probably damaging Het
Aen A T 7: 78,902,639 probably null Het
Ankrd55 A G 13: 112,318,446 D26G probably damaging Het
Antxr2 T C 5: 98,004,272 E160G possibly damaging Het
Auts2 T C 5: 131,440,223 H528R probably damaging Het
Casd1 A G 6: 4,641,948 T742A probably damaging Het
Ccdc39 T C 3: 33,841,192 probably null Het
Ctla4 T C 1: 60,912,491 Y60H probably damaging Het
Dennd4b T C 3: 90,276,259 L935P probably damaging Het
Dnah6 T A 6: 73,188,494 T543S probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fdxacb1 C T 9: 50,772,602 R420* probably null Het
Flg A G 3: 93,292,716 probably benign Het
Fpr1 T A 17: 17,877,635 I31F probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gsta1 T A 9: 78,242,565 F220Y probably damaging Het
Hmg20a T A 9: 56,488,607 probably null Het
Igf2bp1 A C 11: 95,974,020 L201R probably damaging Het
Jph3 G A 8: 121,753,087 R168H probably damaging Het
Kif1a T A 1: 93,036,901 I1318F probably damaging Het
Lamc2 T C 1: 153,136,777 N717S probably benign Het
Lepr A T 4: 101,765,372 S450C probably damaging Het
Muc16 A G 9: 18,590,698 V6535A probably damaging Het
Myom3 A G 4: 135,762,571 T18A probably benign Het
Nlrp5 A G 7: 23,404,173 K22E probably benign Het
Obscn A C 11: 59,077,945 S2534A possibly damaging Het
Olfr318 A G 11: 58,720,307 V247A probably damaging Het
Olfr50 A T 2: 36,794,043 D269V probably benign Het
Pcdhga8 T A 18: 37,727,527 N545K possibly damaging Het
Pcsk5 A T 19: 17,511,556 Y967N probably damaging Het
Ppp1r32 G A 19: 10,477,764 P233L probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scap A G 9: 110,380,379 T707A possibly damaging Het
Scarf1 A G 11: 75,525,739 Q669R probably benign Het
Scin T C 12: 40,069,436 D531G probably benign Het
Sh2b3 T C 5: 121,815,563 probably null Het
Slco1a6 T C 6: 142,086,429 S657G probably benign Het
Stil T A 4: 115,029,861 probably null Het
Syna T A 5: 134,558,268 Q609L possibly damaging Het
Tmem59l A G 8: 70,484,605 S271P probably damaging Het
Tns2 A G 15: 102,111,241 E522G probably damaging Het
Trappc6a G A 7: 19,515,294 A149T probably benign Het
Trim21 A T 7: 102,563,291 L156H possibly damaging Het
Trpv3 A G 11: 73,296,483 R714G possibly damaging Het
Zfp72 T A 13: 74,372,341 Q206L possibly damaging Het
Other mutations in Wdr63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Wdr63 APN 3 146083004 missense probably benign
IGL00565:Wdr63 APN 3 146044919 splice site probably benign
IGL01339:Wdr63 APN 3 146042836 missense probably benign 0.14
IGL01952:Wdr63 APN 3 146097163 missense probably damaging 0.96
IGL02663:Wdr63 APN 3 146054557 missense possibly damaging 0.53
IGL02710:Wdr63 APN 3 146048148 missense possibly damaging 0.96
P0041:Wdr63 UTSW 3 146081242 missense possibly damaging 0.96
R0014:Wdr63 UTSW 3 146081423 splice site probably null
R0014:Wdr63 UTSW 3 146081423 splice site probably null
R0498:Wdr63 UTSW 3 146081364 missense possibly damaging 0.54
R0589:Wdr63 UTSW 3 146062331 missense probably benign 0.01
R1484:Wdr63 UTSW 3 146097241 missense probably benign 0.02
R1537:Wdr63 UTSW 3 146042749 missense probably damaging 0.98
R1611:Wdr63 UTSW 3 146095358 missense probably damaging 1.00
R1743:Wdr63 UTSW 3 146097262 missense possibly damaging 0.81
R1861:Wdr63 UTSW 3 146083046 missense probably damaging 1.00
R1991:Wdr63 UTSW 3 146063480 missense possibly damaging 0.82
R2185:Wdr63 UTSW 3 146066864 missense possibly damaging 0.76
R4299:Wdr63 UTSW 3 146068806 missense probably damaging 1.00
R4620:Wdr63 UTSW 3 146042809 missense probably damaging 1.00
R4649:Wdr63 UTSW 3 146048167 missense probably damaging 1.00
R4914:Wdr63 UTSW 3 146066827 missense probably damaging 0.98
R4948:Wdr63 UTSW 3 146083065 nonsense probably null
R5578:Wdr63 UTSW 3 146097228 nonsense probably null
R6162:Wdr63 UTSW 3 146044862 missense probably damaging 1.00
R6291:Wdr63 UTSW 3 146066893 missense probably benign 0.00
R6390:Wdr63 UTSW 3 146095388 missense probably damaging 1.00
R6560:Wdr63 UTSW 3 146095406 missense possibly damaging 0.79
R6893:Wdr63 UTSW 3 146080429 missense probably damaging 1.00
R7090:Wdr63 UTSW 3 146040827 missense possibly damaging 0.80
R7102:Wdr63 UTSW 3 146055704 missense possibly damaging 0.49
R7111:Wdr63 UTSW 3 146097273 missense probably damaging 0.99
R7260:Wdr63 UTSW 3 146046540 missense probably benign 0.01
R7288:Wdr63 UTSW 3 146081252 missense probably damaging 0.97
R7411:Wdr63 UTSW 3 146097145 missense probably damaging 0.98
R7466:Wdr63 UTSW 3 146055618 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAGGGAGCACACAGGACTC -3'
(R):5'- TCCACTATGGTTAAGAAGGTGGTTG -3'

Sequencing Primer
(F):5'- ACACAGGACTCTCGTGGGATG -3'
(R):5'- TTGGTGTCATCAGGCGAC -3'
Posted On2017-10-10