Incidental Mutation 'R6132:Olfr994'
ID487164
Institutional Source Beutler Lab
Gene Symbol Olfr994
Ensembl Gene ENSMUSG00000075219
Gene Nameolfactory receptor 994
SynonymsMOR203-4, GA_x6K02T2Q125-46907515-46906571
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6132 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85429380-85436451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85430146 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 228 (S228T)
Ref Sequence ENSEMBL: ENSMUSP00000149417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099925] [ENSMUST00000214679] [ENSMUST00000217218]
Predicted Effect probably benign
Transcript: ENSMUST00000099925
AA Change: S228T

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097509
Gene: ENSMUSG00000075219
AA Change: S228T

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 5.1e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 302 3.5e-5 PFAM
Pfam:7tm_1 41 289 8.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214679
AA Change: S228T

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215758
Predicted Effect probably benign
Transcript: ENSMUST00000217218
AA Change: S228T

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik C T 4: 41,517,160 M1I probably null Het
Abca15 T C 7: 120,361,420 Y702H probably benign Het
Adgrv1 G T 13: 81,506,076 N2225K probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh5 G T 11: 60,537,995 probably benign Het
Atp5g1 A G 11: 96,075,024 M1T probably null Het
Crebrf C T 17: 26,763,403 P588S probably benign Het
Ctsr A C 13: 61,161,768 probably null Het
Cyp2c68 A G 19: 39,703,414 V355A possibly damaging Het
Ddx52 A G 11: 83,959,457 K555E possibly damaging Het
Depdc5 T A 5: 32,910,467 S410T probably damaging Het
Dhx30 A T 9: 110,085,779 I884N probably damaging Het
Dlg1 A T 16: 31,836,241 N518I possibly damaging Het
Dnah12 T A 14: 26,717,911 I506N probably damaging Het
Efcab6 A G 15: 84,032,972 L129P probably damaging Het
Erap1 A G 13: 74,660,282 N38D probably benign Het
Esf1 A G 2: 140,159,779 F383L probably benign Het
Exoc4 A G 6: 33,758,098 E550G probably damaging Het
Fbxo44 G A 4: 148,156,108 T221I probably benign Het
Gal3st2b A T 1: 93,939,966 M112L possibly damaging Het
Golph3l C G 3: 95,591,834 P96A probably benign Het
Gprc6a T A 10: 51,615,260 I727F possibly damaging Het
Grin3b T C 10: 79,976,440 L479P probably damaging Het
Kdm5a C T 6: 120,374,931 H161Y probably damaging Het
Lman2 A G 13: 55,362,225 S73P probably benign Het
Map3k19 T C 1: 127,850,476 N4S possibly damaging Het
Mkln1 G A 6: 31,431,220 V161M probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Nrcam T A 12: 44,570,224 Y668N probably damaging Het
Oacyl G T 18: 65,726,355 G255W probably damaging Het
Olfr201 A G 16: 59,269,004 V221A probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Omd A C 13: 49,590,367 I298L probably damaging Het
Otor A T 2: 143,078,600 D34V probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pwwp2a A G 11: 43,705,628 Y540C probably damaging Het
Rttn T A 18: 89,115,646 probably null Het
S1pr4 G A 10: 81,499,196 A148V probably benign Het
Scn10a C T 9: 119,613,695 V1495M possibly damaging Het
Sel1l3 T C 5: 53,200,189 K154E possibly damaging Het
Sema3a T G 5: 13,523,175 probably null Het
Slf2 T A 19: 44,960,861 N870K possibly damaging Het
Syne2 T C 12: 75,945,147 V1962A probably benign Het
Tarbp1 T A 8: 126,434,809 I1219F probably benign Het
Tet1 A C 10: 62,813,300 C173W probably damaging Het
Tnn A G 1: 160,146,071 F242S probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn2r106 T C 17: 20,268,404 T578A probably benign Het
Zfp457 G T 13: 67,293,296 S309* probably null Het
Other mutations in Olfr994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr994 APN 2 85430140 missense probably benign 0.00
IGL01325:Olfr994 APN 2 85430295 missense possibly damaging 0.60
IGL01634:Olfr994 APN 2 85430439 missense probably damaging 1.00
IGL01809:Olfr994 APN 2 85430154 missense probably damaging 1.00
IGL02586:Olfr994 APN 2 85430466 missense possibly damaging 0.80
IGL02711:Olfr994 APN 2 85430739 missense probably damaging 0.97
R0010:Olfr994 UTSW 2 85429895 missense probably benign
R0578:Olfr994 UTSW 2 85430673 missense probably benign 0.03
R0848:Olfr994 UTSW 2 85430021 missense probably benign 0.03
R1844:Olfr994 UTSW 2 85429921 missense probably benign 0.03
R1912:Olfr994 UTSW 2 85430260 missense probably damaging 0.97
R1959:Olfr994 UTSW 2 85430619 missense probably damaging 1.00
R2014:Olfr994 UTSW 2 85430352 missense possibly damaging 0.89
R2113:Olfr994 UTSW 2 85430086 missense probably damaging 1.00
R2290:Olfr994 UTSW 2 85430200 missense possibly damaging 0.64
R3622:Olfr994 UTSW 2 85430493 missense probably benign 0.12
R3918:Olfr994 UTSW 2 85430730 missense possibly damaging 0.64
R4175:Olfr994 UTSW 2 85430618 missense probably damaging 1.00
R4945:Olfr994 UTSW 2 85430551 missense probably benign 0.03
R6439:Olfr994 UTSW 2 85430724 missense probably damaging 1.00
R6713:Olfr994 UTSW 2 85430539 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCATGGGAATCACAATGCC -3'
(R):5'- TCGGCAAGTCTGTGTTCAG -3'

Sequencing Primer
(F):5'- TGGGAATCACAATGCCATAAAAC -3'
(R):5'- ACTGTCCTTCTGTGCATCAAAAATC -3'
Posted On2017-10-10