Incidental Mutation 'R6132:Depdc5'
ID487172
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene NameDEP domain containing 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R6132 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location32863701-32994236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32910467 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 410 (S410T)
Ref Sequence ENSEMBL: ENSMUSP00000113980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000195980]
Predicted Effect probably benign
Transcript: ENSMUST00000049780
AA Change: S410T

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: S410T

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087897
AA Change: S410T

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: S410T

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119705
AA Change: S410T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: S410T

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120902
AA Change: S410T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: S410T

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158455
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201802
Predicted Effect probably benign
Transcript: ENSMUST00000201836
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik C T 4: 41,517,160 M1I probably null Het
Abca15 T C 7: 120,361,420 Y702H probably benign Het
Adgrv1 G T 13: 81,506,076 N2225K probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh5 G T 11: 60,537,995 probably benign Het
Atp5g1 A G 11: 96,075,024 M1T probably null Het
Crebrf C T 17: 26,763,403 P588S probably benign Het
Ctsr A C 13: 61,161,768 probably null Het
Cyp2c68 A G 19: 39,703,414 V355A possibly damaging Het
Ddx52 A G 11: 83,959,457 K555E possibly damaging Het
Dhx30 A T 9: 110,085,779 I884N probably damaging Het
Dlg1 A T 16: 31,836,241 N518I possibly damaging Het
Dnah12 T A 14: 26,717,911 I506N probably damaging Het
Efcab6 A G 15: 84,032,972 L129P probably damaging Het
Erap1 A G 13: 74,660,282 N38D probably benign Het
Esf1 A G 2: 140,159,779 F383L probably benign Het
Exoc4 A G 6: 33,758,098 E550G probably damaging Het
Fbxo44 G A 4: 148,156,108 T221I probably benign Het
Gal3st2b A T 1: 93,939,966 M112L possibly damaging Het
Golph3l C G 3: 95,591,834 P96A probably benign Het
Gprc6a T A 10: 51,615,260 I727F possibly damaging Het
Grin3b T C 10: 79,976,440 L479P probably damaging Het
Kdm5a C T 6: 120,374,931 H161Y probably damaging Het
Lman2 A G 13: 55,362,225 S73P probably benign Het
Map3k19 T C 1: 127,850,476 N4S possibly damaging Het
Mkln1 G A 6: 31,431,220 V161M probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Nrcam T A 12: 44,570,224 Y668N probably damaging Het
Oacyl G T 18: 65,726,355 G255W probably damaging Het
Olfr201 A G 16: 59,269,004 V221A probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr994 A T 2: 85,430,146 S228T probably benign Het
Omd A C 13: 49,590,367 I298L probably damaging Het
Otor A T 2: 143,078,600 D34V probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pwwp2a A G 11: 43,705,628 Y540C probably damaging Het
Rttn T A 18: 89,115,646 probably null Het
S1pr4 G A 10: 81,499,196 A148V probably benign Het
Scn10a C T 9: 119,613,695 V1495M possibly damaging Het
Sel1l3 T C 5: 53,200,189 K154E possibly damaging Het
Sema3a T G 5: 13,523,175 probably null Het
Slf2 T A 19: 44,960,861 N870K possibly damaging Het
Syne2 T C 12: 75,945,147 V1962A probably benign Het
Tarbp1 T A 8: 126,434,809 I1219F probably benign Het
Tet1 A C 10: 62,813,300 C173W probably damaging Het
Tnn A G 1: 160,146,071 F242S probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn2r106 T C 17: 20,268,404 T578A probably benign Het
Zfp457 G T 13: 67,293,296 S309* probably null Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 32967814 splice site probably null
IGL01019:Depdc5 APN 5 32893401 missense probably damaging 0.96
IGL01067:Depdc5 APN 5 32899067 splice site probably null
IGL01405:Depdc5 APN 5 32937689 missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 32955897 missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 32924200 missense probably damaging 1.00
IGL01998:Depdc5 APN 5 32945151 splice site probably benign
IGL02025:Depdc5 APN 5 32946632 critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 32903801 missense probably damaging 1.00
IGL02537:Depdc5 APN 5 32967787 missense probably damaging 1.00
IGL02812:Depdc5 APN 5 32893368 splice site probably benign
IGL03001:Depdc5 APN 5 32945090 missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 32868813 unclassified probably benign
IGL02988:Depdc5 UTSW 5 32956167 utr 3 prime probably null
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0153:Depdc5 UTSW 5 32933937 splice site probably benign
R0179:Depdc5 UTSW 5 32901574 unclassified probably benign
R0212:Depdc5 UTSW 5 32912242 missense probably benign 0.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0302:Depdc5 UTSW 5 32904546 critical splice donor site probably benign
R0511:Depdc5 UTSW 5 32945028 nonsense probably null
R0677:Depdc5 UTSW 5 32901470 missense probably damaging 1.00
R0884:Depdc5 UTSW 5 32917978 missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 32986966 missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 32877074 missense probably damaging 1.00
R1611:Depdc5 UTSW 5 32990953 missense probably damaging 1.00
R1687:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 32917942 missense probably benign 0.24
R1903:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 32903831 missense probably damaging 1.00
R1997:Depdc5 UTSW 5 32901906 critical splice donor site probably null
R2079:Depdc5 UTSW 5 32946674 missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 32990781 nonsense probably null
R2291:Depdc5 UTSW 5 32979402 missense probably damaging 1.00
R2422:Depdc5 UTSW 5 32991035 missense probably damaging 1.00
R2851:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2852:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2937:Depdc5 UTSW 5 32901621 intron probably null
R2938:Depdc5 UTSW 5 32901621 intron probably null
R2974:Depdc5 UTSW 5 32934017 critical splice donor site probably null
R3884:Depdc5 UTSW 5 32944077 missense probably damaging 1.00
R3967:Depdc5 UTSW 5 32944115 nonsense probably null
R4118:Depdc5 UTSW 5 32964635 missense probably damaging 1.00
R4197:Depdc5 UTSW 5 32991203 missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 32904534 critical splice donor site probably null
R4534:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 32983946 missense probably damaging 1.00
R4613:Depdc5 UTSW 5 32975446 missense probably damaging 1.00
R4736:Depdc5 UTSW 5 32975322 missense probably benign
R4738:Depdc5 UTSW 5 32975322 missense probably benign
R4765:Depdc5 UTSW 5 32937635 missense probably damaging 1.00
R5021:Depdc5 UTSW 5 32979414 missense probably damaging 1.00
R5259:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5261:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5541:Depdc5 UTSW 5 32864629 utr 5 prime probably benign
R5594:Depdc5 UTSW 5 32901490 missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 32975506 nonsense probably null
R6146:Depdc5 UTSW 5 32968731 missense probably benign 0.01
R6336:Depdc5 UTSW 5 32964507 unclassified probably null
R6468:Depdc5 UTSW 5 32912231 missense probably benign 0.02
R6911:Depdc5 UTSW 5 32924192 missense probably damaging 1.00
R6969:Depdc5 UTSW 5 32983860 missense probably damaging 1.00
X0027:Depdc5 UTSW 5 32904292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTTGCCTTAAGGTTTAGC -3'
(R):5'- CCCTGTTTATGACCCTAGGC -3'

Sequencing Primer
(F):5'- GGTATACTAGGGGCCAACTTTATCC -3'
(R):5'- CCTAGGCAGGGGAGAGG -3'
Posted On2017-10-10