Incidental Mutation 'R6132:Nova2'
ID487177
Institutional Source Beutler Lab
Gene Symbol Nova2
Ensembl Gene ENSMUSG00000030411
Gene Nameneuro-oncological ventral antigen 2
SynonymsLOC384569
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6132 (G1)
Quality Score97.0083
Status Not validated
Chromosome7
Chromosomal Location18925888-18965319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18957869 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 244 (A244T)
Ref Sequence ENSEMBL: ENSMUSP00000151939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032571] [ENSMUST00000220302]
Predicted Effect unknown
Transcript: ENSMUST00000032571
AA Change: A308T
SMART Domains Protein: ENSMUSP00000032571
Gene: ENSMUSG00000030411
AA Change: A308T

DomainStartEndE-ValueType
KH 31 104 2.19e-13 SMART
KH 129 201 6.95e-16 SMART
low complexity region 232 270 N/A INTRINSIC
low complexity region 290 393 N/A INTRINSIC
KH 405 478 1.94e-14 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000134257
Gene: ENSMUSG00000108585
AA Change: A244T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
KH 95 168 2.19e-13 SMART
KH 193 265 6.95e-16 SMART
low complexity region 296 334 N/A INTRINSIC
low complexity region 354 457 N/A INTRINSIC
KH 469 542 1.94e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181954
Predicted Effect unknown
Transcript: ENSMUST00000220302
AA Change: A244T
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (49/51)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, abolished long term potentiation of the small inhibitory postsynaptic current but not the excitatory postsynaptic current, and no pairing-induced potentiation of small inhibitory postsynatpic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik C T 4: 41,517,160 M1I probably null Het
Abca15 T C 7: 120,361,420 Y702H probably benign Het
Adgrv1 G T 13: 81,506,076 N2225K probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh5 G T 11: 60,537,995 probably benign Het
Atp5g1 A G 11: 96,075,024 M1T probably null Het
Crebrf C T 17: 26,763,403 P588S probably benign Het
Ctsr A C 13: 61,161,768 probably null Het
Cyp2c68 A G 19: 39,703,414 V355A possibly damaging Het
Ddx52 A G 11: 83,959,457 K555E possibly damaging Het
Depdc5 T A 5: 32,910,467 S410T probably damaging Het
Dhx30 A T 9: 110,085,779 I884N probably damaging Het
Dlg1 A T 16: 31,836,241 N518I possibly damaging Het
Dnah12 T A 14: 26,717,911 I506N probably damaging Het
Efcab6 A G 15: 84,032,972 L129P probably damaging Het
Erap1 A G 13: 74,660,282 N38D probably benign Het
Esf1 A G 2: 140,159,779 F383L probably benign Het
Exoc4 A G 6: 33,758,098 E550G probably damaging Het
Fbxo44 G A 4: 148,156,108 T221I probably benign Het
Gal3st2b A T 1: 93,939,966 M112L possibly damaging Het
Golph3l C G 3: 95,591,834 P96A probably benign Het
Gprc6a T A 10: 51,615,260 I727F possibly damaging Het
Grin3b T C 10: 79,976,440 L479P probably damaging Het
Kdm5a C T 6: 120,374,931 H161Y probably damaging Het
Lman2 A G 13: 55,362,225 S73P probably benign Het
Map3k19 T C 1: 127,850,476 N4S possibly damaging Het
Mkln1 G A 6: 31,431,220 V161M probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Nrcam T A 12: 44,570,224 Y668N probably damaging Het
Oacyl G T 18: 65,726,355 G255W probably damaging Het
Olfr201 A G 16: 59,269,004 V221A probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr994 A T 2: 85,430,146 S228T probably benign Het
Omd A C 13: 49,590,367 I298L probably damaging Het
Otor A T 2: 143,078,600 D34V probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pwwp2a A G 11: 43,705,628 Y540C probably damaging Het
Rttn T A 18: 89,115,646 probably null Het
S1pr4 G A 10: 81,499,196 A148V probably benign Het
Scn10a C T 9: 119,613,695 V1495M possibly damaging Het
Sel1l3 T C 5: 53,200,189 K154E possibly damaging Het
Sema3a T G 5: 13,523,175 probably null Het
Slf2 T A 19: 44,960,861 N870K possibly damaging Het
Syne2 T C 12: 75,945,147 V1962A probably benign Het
Tarbp1 T A 8: 126,434,809 I1219F probably benign Het
Tet1 A C 10: 62,813,300 C173W probably damaging Het
Tnn A G 1: 160,146,071 F242S probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn2r106 T C 17: 20,268,404 T578A probably benign Het
Zfp457 G T 13: 67,293,296 S309* probably null Het
Other mutations in Nova2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03088:Nova2 APN 7 18950569 missense unknown
R1529:Nova2 UTSW 7 18957554 missense probably damaging 0.99
R1858:Nova2 UTSW 7 18958401 missense probably damaging 1.00
R5130:Nova2 UTSW 7 18926144 missense unknown
R5402:Nova2 UTSW 7 18958446 missense probably damaging 1.00
R6075:Nova2 UTSW 7 18957869 missense unknown
R6077:Nova2 UTSW 7 18957869 missense unknown
R6134:Nova2 UTSW 7 18957869 missense unknown
R6727:Nova2 UTSW 7 18958494 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCAACCTGCAAGAGCG -3'
(R):5'- GATCTCCACCAGCTCCTTGG -3'

Sequencing Primer
(F):5'- AAGAGCGCGTGGTGACC -3'
(R):5'- TTCTCGGCCGTCAGGAAG -3'
Posted On2017-10-10