Incidental Mutation 'R6133:Ptpn1'
ID 487224
Institutional Source Beutler Lab
Gene Symbol Ptpn1
Ensembl Gene ENSMUSG00000027540
Gene Name protein tyrosine phosphatase, non-receptor type 1
Synonyms PTP1B, PTP-1B
MMRRC Submission 044280-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.916) question?
Stock # R6133 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 167773977-167821305 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 167809716 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 108 (V108A)
Ref Sequence ENSEMBL: ENSMUSP00000029053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029053]
AlphaFold P35821
Predicted Effect possibly damaging
Transcript: ENSMUST00000029053
AA Change: V108A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029053
Gene: ENSMUSG00000027540
AA Change: V108A

DomainStartEndE-ValueType
PTPc 15 279 1.35e-123 SMART
low complexity region 301 320 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151705
Meta Mutation Damage Score 0.7584 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the founding member of the protein tyrosine phosphatase (PTP) family, which was isolated and identified based on its enzymatic activity and amino acid sequence. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP has been shown to act as a negative regulator of insulin signaling by dephosphorylating the phosphotryosine residues of insulin receptor kinase. This PTP was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of this PTP in cell growth control, and cell response to interferon stimulation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit greatly reduced adiposity due to reduced fat cell mass, increased basal metabolic rate, mild hypoglycemia and hypoinsulinemia, increased insulin sensitivity, and enhanced sensitivity to leptin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 89,052,067 (GRCm39) T912A possibly damaging Het
Akap12 G T 10: 4,305,178 (GRCm39) G663C probably benign Het
Ankhd1 T C 18: 36,758,179 (GRCm39) S958P possibly damaging Het
Cmtm2a T C 8: 105,019,362 (GRCm39) I76V probably benign Het
Cpxm2 G A 7: 131,730,182 (GRCm39) P146S probably damaging Het
Cubn A G 2: 13,313,429 (GRCm39) V3047A probably benign Het
Dgkd T A 1: 87,865,962 (GRCm39) V198E possibly damaging Het
Dnah3 A T 7: 119,685,469 (GRCm39) M181K probably benign Het
Dnah7a T C 1: 53,458,814 (GRCm39) T3775A probably benign Het
Dsg2 A G 18: 20,723,146 (GRCm39) I391V probably benign Het
Ebi3 T A 17: 56,261,311 (GRCm39) V69E probably benign Het
Fn1 T C 1: 71,636,886 (GRCm39) T1998A probably damaging Het
Frmpd1 T A 4: 45,284,915 (GRCm39) H1245Q probably benign Het
Gm7145 T A 1: 117,913,618 (GRCm39) C167S probably damaging Het
Hydin C T 8: 111,327,908 (GRCm39) T4805I probably benign Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kcnma1 C T 14: 24,053,936 (GRCm39) M21I probably damaging Het
Lrfn5 A G 12: 61,890,574 (GRCm39) D621G probably benign Het
Lrrc15 C T 16: 30,093,054 (GRCm39) G95D probably benign Het
Mex3d A G 10: 80,222,620 (GRCm39) L212P probably damaging Het
Mmel1 C T 4: 154,979,475 (GRCm39) H728Y probably damaging Het
Naip1 A G 13: 100,581,151 (GRCm39) V32A probably benign Het
Nsl1 T C 1: 190,803,403 (GRCm39) L158P probably damaging Het
Or51q1c A T 7: 103,652,532 (GRCm39) T17S possibly damaging Het
Or6c202 G A 10: 128,996,752 (GRCm39) L34F possibly damaging Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Pakap C T 4: 57,855,516 (GRCm39) Q525* probably null Het
Pcdh15 A T 10: 74,481,805 (GRCm39) probably null Het
Pramel15 T C 4: 144,104,347 (GRCm39) R53G possibly damaging Het
Rad9b T C 5: 122,477,831 (GRCm39) N182D possibly damaging Het
Rp1l1 C T 14: 64,267,545 (GRCm39) P1044S probably damaging Het
Scn2a G A 2: 65,573,448 (GRCm39) V1433I probably benign Het
Ssrp1 T G 2: 84,875,683 (GRCm39) probably benign Het
Suco T A 1: 161,662,752 (GRCm39) K560* probably null Het
Tbx3 T C 5: 119,819,018 (GRCm39) V531A probably benign Het
Tmem30c T C 16: 57,098,100 (GRCm39) Y107C probably damaging Het
Topbp1 T A 9: 103,188,963 (GRCm39) probably null Het
Trpm5 A T 7: 142,642,688 (GRCm39) D86E probably damaging Het
Urb2 C T 8: 124,755,300 (GRCm39) Q336* probably null Het
Vmn2r43 A G 7: 8,247,970 (GRCm39) F731S probably damaging Het
Xkr9 A G 1: 13,754,359 (GRCm39) T118A probably benign Het
Zcchc2 A C 1: 105,947,609 (GRCm39) K117N probably damaging Het
Zfp52 T C 17: 21,780,733 (GRCm39) Y194H probably damaging Het
Zfp763 C T 17: 33,237,675 (GRCm39) C490Y possibly damaging Het
Zmynd19 G T 2: 24,848,131 (GRCm39) R148L possibly damaging Het
Other mutations in Ptpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Ptpn1 APN 2 167,809,712 (GRCm39) missense probably damaging 1.00
IGL02976:Ptpn1 APN 2 167,813,704 (GRCm39) missense probably benign 0.01
escondido UTSW 2 167,816,161 (GRCm39) missense probably damaging 1.00
R0106:Ptpn1 UTSW 2 167,818,338 (GRCm39) unclassified probably benign
R0106:Ptpn1 UTSW 2 167,818,338 (GRCm39) unclassified probably benign
R1438:Ptpn1 UTSW 2 167,818,529 (GRCm39) missense probably damaging 0.99
R3010:Ptpn1 UTSW 2 167,816,742 (GRCm39) missense probably damaging 1.00
R3607:Ptpn1 UTSW 2 167,817,427 (GRCm39) missense probably benign
R3755:Ptpn1 UTSW 2 167,816,143 (GRCm39) missense probably damaging 1.00
R4075:Ptpn1 UTSW 2 167,818,433 (GRCm39) splice site probably null
R4160:Ptpn1 UTSW 2 167,809,731 (GRCm39) missense probably benign 0.04
R4627:Ptpn1 UTSW 2 167,809,701 (GRCm39) missense probably benign 0.00
R4754:Ptpn1 UTSW 2 167,816,080 (GRCm39) missense probably damaging 1.00
R5596:Ptpn1 UTSW 2 167,816,683 (GRCm39) missense probably damaging 1.00
R5920:Ptpn1 UTSW 2 167,813,668 (GRCm39) missense probably benign 0.02
R7296:Ptpn1 UTSW 2 167,816,692 (GRCm39) missense probably damaging 0.98
R8350:Ptpn1 UTSW 2 167,816,161 (GRCm39) missense probably damaging 1.00
R9275:Ptpn1 UTSW 2 167,816,176 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACATGATGGGATGTGGGAC -3'
(R):5'- CTCCCTAGTGTGGTCTGTAATAAAAG -3'

Sequencing Primer
(F):5'- GGACTGGGTGACTGACGG -3'
(R):5'- GGGGAGCTTTAAGAACTG -3'
Posted On 2017-10-10