Incidental Mutation 'R6134:Speer4f1'
ID487268
Institutional Source Beutler Lab
Gene Symbol Speer4f1
Ensembl Gene ENSMUSG00000058643
Gene Namespermatogenesis associated glutamate (E)-rich protein 4F1
Synonyms4922502J04Rik, Speer4f, SPEER-4F
MMRRC Submission 044281-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6134 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location17476098-17480936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17476142 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 6 (R6Q)
Ref Sequence ENSEMBL: ENSMUSP00000075467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076099]
Predicted Effect probably benign
Transcript: ENSMUST00000076099
AA Change: R6Q

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075467
Gene: ENSMUSG00000058643
AA Change: R6Q

DomainStartEndE-ValueType
Pfam:Takusan 50 128 1.2e-19 PFAM
low complexity region 224 258 N/A INTRINSIC
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,876,793 E39K probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aktip T A 8: 91,129,760 S30C probably damaging Het
Anxa10 G T 8: 62,077,943 H78N probably damaging Het
Aoah C T 13: 20,911,123 R196W probably damaging Het
Arl4c A T 1: 88,701,430 W79R probably damaging Het
Brd2 A T 17: 34,113,695 D178E probably benign Het
Cacna1e G A 1: 154,701,291 P120L probably damaging Het
Cdh16 A T 8: 104,616,065 M17K probably benign Het
Chit1 A G 1: 134,144,060 T103A possibly damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Coch T A 12: 51,602,753 D282E probably damaging Het
Col1a2 C A 6: 4,538,035 S1181R unknown Het
Col6a2 T C 10: 76,607,144 D506G probably damaging Het
Crx A T 7: 15,868,107 Y215* probably null Het
Fam160a1 T C 3: 85,673,344 E518G possibly damaging Het
Fasn A T 11: 120,822,186 S58T probably benign Het
Garem1 A T 18: 21,129,824 D644E probably benign Het
Gm4763 G A 7: 24,726,056 A3V probably damaging Het
H2-Q2 A C 17: 35,343,241 T155P probably damaging Het
Insr A T 8: 3,192,572 I49N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lnpep A G 17: 17,553,192 M639T probably benign Het
Map3k20 C T 2: 72,410,159 S333F probably damaging Het
Miga2 A G 2: 30,371,217 S175G probably benign Het
Muc3a A T 5: 137,210,122 I191N probably damaging Het
Ncoa2 A G 1: 13,174,371 V701A probably damaging Het
Nid2 T C 14: 19,778,783 V565A probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Numbl G C 7: 27,281,314 A574P probably damaging Het
Oas3 A G 5: 120,769,048 V508A unknown Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pcdhb21 T A 18: 37,514,408 S197T probably benign Het
Pck2 T A 14: 55,543,962 M180K probably damaging Het
Pgr T C 9: 8,900,739 V91A possibly damaging Het
Phtf1 A T 3: 104,004,405 M643L probably damaging Het
Prokr1 T C 6: 87,588,855 T3A possibly damaging Het
Ptgs1 T C 2: 36,251,178 Y546H probably damaging Het
Rasa1 A G 13: 85,226,626 L742P probably benign Het
Rbbp6 T C 7: 122,997,311 probably null Het
Rgs22 A G 15: 36,107,048 L64P probably damaging Het
Rnf213 A T 11: 119,411,470 I407F probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
RP24-388A6.3 A T 5: 16,824,685 D473V probably damaging Het
Scin G A 12: 40,060,579 P690L probably damaging Het
Sept9 T C 11: 117,352,161 L58P probably damaging Het
Slc1a7 A G 4: 108,012,436 E566G probably damaging Het
Tnxb A T 17: 34,672,012 Y443F probably damaging Het
Trpv1 A G 11: 73,244,317 I79V probably benign Het
Ttll6 C T 11: 96,139,742 T245I possibly damaging Het
Vmn2r26 T C 6: 124,061,485 I673T probably damaging Het
Zfp60 T C 7: 27,749,898 F664L probably benign Het
Other mutations in Speer4f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03344:Speer4f1 APN 5 17480334 missense possibly damaging 0.88
IGL02837:Speer4f1 UTSW 5 17480383 missense unknown
PIT4508001:Speer4f1 UTSW 5 17480414 missense unknown
PIT4514001:Speer4f1 UTSW 5 17478756 missense possibly damaging 0.94
R0165:Speer4f1 UTSW 5 17479514 nonsense probably null
R1557:Speer4f1 UTSW 5 17479492 missense probably damaging 1.00
R1740:Speer4f1 UTSW 5 17478761 missense probably damaging 1.00
R2332:Speer4f1 UTSW 5 17479524 missense probably damaging 0.99
R3890:Speer4f1 UTSW 5 17479502 missense probably damaging 0.98
R4659:Speer4f1 UTSW 5 17476223 missense possibly damaging 0.75
R4718:Speer4f1 UTSW 5 17480424 missense unknown
R5322:Speer4f1 UTSW 5 17477349 missense possibly damaging 0.47
R6075:Speer4f1 UTSW 5 17479484 missense possibly damaging 0.95
R6192:Speer4f1 UTSW 5 17479495 missense probably damaging 1.00
R6277:Speer4f1 UTSW 5 17476243 missense probably damaging 0.99
R6803:Speer4f1 UTSW 5 17479390 splice site probably null
Z1088:Speer4f1 UTSW 5 17479479 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTCAGCTTCCTGTCAGTAC -3'
(R):5'- TCCAGTTCCACATTACTAGAAAGG -3'

Sequencing Primer
(F):5'- TGTCAGTACAGGGAGAACATTAGC -3'
(R):5'- TTACTAGAAAGGACAGCTCAGGCC -3'
Posted On2017-10-10