Incidental Mutation 'R6125:Slco3a1'
ID487339
Institutional Source Beutler Lab
Gene Symbol Slco3a1
Ensembl Gene ENSMUSG00000025790
Gene Namesolute carrier organic anion transporter family, member 3a1
SynonymsOATP-D, Slc21a11, 5830414C08Rik, MJAM, Anr1
MMRRC Submission 044272-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R6125 (G1)
Quality Score184.009
Status Validated
Chromosome7
Chromosomal Location74275419-74554780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74318506 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 489 (D489N)
Ref Sequence ENSEMBL: ENSMUSP00000103077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026897] [ENSMUST00000098371] [ENSMUST00000107453]
Predicted Effect probably benign
Transcript: ENSMUST00000026897
AA Change: D489N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000026897
Gene: ENSMUSG00000025790
AA Change: D489N

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
Pfam:MFS_1 44 455 1.2e-27 PFAM
KAZAL 474 509 2.77e-1 SMART
low complexity region 574 594 N/A INTRINSIC
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098371
AA Change: D489N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000095973
Gene: ENSMUSG00000025790
AA Change: D489N

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
Pfam:MFS_1 44 456 1.2e-27 PFAM
KAZAL 474 509 2.77e-1 SMART
low complexity region 574 594 N/A INTRINSIC
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107453
AA Change: D489N

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103077
Gene: ENSMUSG00000025790
AA Change: D489N

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
Pfam:MFS_1 45 456 2e-27 PFAM
KAZAL 474 509 2.77e-1 SMART
low complexity region 574 589 N/A INTRINSIC
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef11 T C 3: 87,729,602 F1023S probably damaging Het
Atp1a1 G A 3: 101,590,707 R255C probably damaging Het
Bbs12 A G 3: 37,320,551 I383V probably benign Het
BC067074 A G 13: 113,317,683 T88A probably benign Het
Cacna1h G A 17: 25,385,694 P1215L probably benign Het
Calm5 A T 13: 3,854,491 K62* probably null Het
Chd8 T A 14: 52,207,034 H398L probably benign Het
Dlgap2 A T 8: 14,727,193 H146L possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dupd1 C A 14: 21,686,690 V115L probably benign Het
Dync2h1 T C 9: 7,168,706 N369S probably damaging Het
Fam84b T C 15: 60,823,297 N200S probably damaging Het
Fer1l4 A C 2: 156,046,987 V422G probably damaging Het
Fstl4 T C 11: 53,186,303 M629T probably benign Het
Galnt18 A G 7: 111,485,193 Y507H probably damaging Het
Gar1 C A 3: 129,830,750 probably benign Het
Gm19402 T C 10: 77,690,673 T29A probably damaging Het
Gm826 A G 2: 160,327,114 F92L unknown Het
H1f0 T A 15: 79,028,870 I50N probably damaging Het
H2-DMb1 A G 17: 34,157,465 Y186C probably damaging Het
Hgf A G 5: 16,598,161 N357S probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hsf2 T C 10: 57,512,005 V415A probably benign Het
Ins2 C A 7: 142,679,693 probably null Het
Kel A T 6: 41,690,786 F89L probably damaging Het
Lrrc37a T C 11: 103,501,560 D1013G probably benign Het
Ltbp4 C A 7: 27,327,755 G397C probably damaging Het
Madd A G 2: 91,152,452 probably null Het
Map4k4 A G 1: 40,003,965 D660G possibly damaging Het
Mdm4 G A 1: 132,994,510 T298I possibly damaging Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mpdz A T 4: 81,297,527 C1487S probably benign Het
Mtus1 A G 8: 41,084,539 S47P probably damaging Het
Nek1 T C 8: 61,028,701 S217P probably damaging Het
Olfr1129 T C 2: 87,575,246 I54T probably benign Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Pcdhb10 T C 18: 37,413,626 V585A possibly damaging Het
Perm1 A G 4: 156,217,719 E240G probably benign Het
Pkdrej T C 15: 85,816,384 T1784A probably damaging Het
Pnpla8 C T 12: 44,307,989 T644M possibly damaging Het
Rgs2 T C 1: 144,004,025 K32E probably damaging Het
Scyl3 A T 1: 163,950,576 M428L probably benign Het
Slc30a8 A G 15: 52,335,134 D325G probably benign Het
Slc5a9 G T 4: 111,883,805 T548K probably damaging Het
Slc9b2 G A 3: 135,330,696 probably null Het
Slit3 T C 11: 35,570,733 probably null Het
Stk39 C A 2: 68,392,124 G199C probably damaging Het
Tbx1 A G 16: 18,583,466 F263L probably damaging Het
Tcf21 G T 10: 22,819,766 N46K probably benign Het
Tdrd9 T A 12: 112,068,198 M1357K possibly damaging Het
Tll1 A G 8: 64,051,487 L625P probably damaging Het
Tmem131 G A 1: 36,808,306 S1237L possibly damaging Het
Trdv5 T C 14: 54,148,841 K56E possibly damaging Het
Triml2 G A 8: 43,187,622 V172I probably benign Het
Trmt44 C A 5: 35,565,498 D409Y probably damaging Het
Ube2o C T 11: 116,541,378 A921T probably damaging Het
Ube2o T C 11: 116,544,750 D404G possibly damaging Het
Ube4b T C 4: 149,398,746 T22A probably benign Het
Ugp2 A T 11: 21,329,815 F327L probably damaging Het
Virma T C 4: 11,521,172 S910P probably damaging Het
Vmn2r9 A G 5: 108,842,970 Y842H probably benign Het
Zfhx4 A G 3: 5,398,811 D1368G possibly damaging Het
Zfp980 T A 4: 145,702,638 *646R probably null Het
Zranb3 T A 1: 127,959,745 N982Y probably benign Het
Other mutations in Slco3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Slco3a1 APN 7 74504183 missense probably damaging 1.00
IGL01124:Slco3a1 APN 7 74284547 missense probably damaging 1.00
IGL01583:Slco3a1 APN 7 74284450 missense probably benign 0.01
IGL01929:Slco3a1 APN 7 74318605 splice site probably benign
IGL01991:Slco3a1 APN 7 74284396 missense possibly damaging 0.84
IGL02380:Slco3a1 APN 7 74554490 missense probably damaging 1.00
IGL03269:Slco3a1 APN 7 74318532 missense possibly damaging 0.58
R0052:Slco3a1 UTSW 7 74504326 missense probably benign 0.00
R0052:Slco3a1 UTSW 7 74504326 missense probably benign 0.00
R0317:Slco3a1 UTSW 7 74504426 missense probably damaging 1.00
R0545:Slco3a1 UTSW 7 74320553 nonsense probably null
R0613:Slco3a1 UTSW 7 74346634 unclassified probably benign
R1488:Slco3a1 UTSW 7 74346701 missense possibly damaging 0.94
R1506:Slco3a1 UTSW 7 74359935 intron probably null
R1571:Slco3a1 UTSW 7 74504380 missense possibly damaging 0.92
R1912:Slco3a1 UTSW 7 74504611 missense probably damaging 1.00
R2011:Slco3a1 UTSW 7 74346671 missense probably benign 0.08
R2382:Slco3a1 UTSW 7 74346776 missense probably benign 0.00
R3735:Slco3a1 UTSW 7 74504497 missense probably damaging 1.00
R3894:Slco3a1 UTSW 7 74284613 missense probably damaging 1.00
R4151:Slco3a1 UTSW 7 74359838 missense probably damaging 1.00
R4175:Slco3a1 UTSW 7 74318554 missense probably damaging 0.97
R4303:Slco3a1 UTSW 7 74554528 missense probably benign 0.03
R4462:Slco3a1 UTSW 7 74554563 missense probably benign 0.18
R4702:Slco3a1 UTSW 7 74320567 missense probably damaging 0.98
R4896:Slco3a1 UTSW 7 74320556 missense probably null 1.00
R5419:Slco3a1 UTSW 7 74284615 missense possibly damaging 0.77
R5561:Slco3a1 UTSW 7 74318499 missense possibly damaging 0.67
R5597:Slco3a1 UTSW 7 74284462 missense probably benign 0.31
R5698:Slco3a1 UTSW 7 74346818 missense probably damaging 1.00
R6086:Slco3a1 UTSW 7 74318590 missense possibly damaging 0.64
R6117:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6118:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6123:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6124:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R7147:Slco3a1 UTSW 7 74504294 missense probably damaging 1.00
R7332:Slco3a1 UTSW 7 74318484 missense possibly damaging 0.95
R7335:Slco3a1 UTSW 7 74284342 missense probably damaging 0.99
X0017:Slco3a1 UTSW 7 74284360 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGACTCAGCAAAGGCCTGG -3'
(R):5'- CAAGCACTTGAAGGTCAGCC -3'

Sequencing Primer
(F):5'- GTCCTGTTGTCCTCCTGATGG -3'
(R):5'- CACTTGAAGGTCAGCCAGGAATAAG -3'
Posted On2017-10-10