Incidental Mutation 'R6126:Robo2'
ID487421
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Nameroundabout guidance receptor 2
Synonyms9430089E08Rik, 2600013A04Rik, D230004I22Rik
MMRRC Submission 044273-MU
Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R6126 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location73891839-74411825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73920682 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 100 (G100S)
Ref Sequence ENSEMBL: ENSMUSP00000156330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000138852] [ENSMUST00000226478]
Predicted Effect unknown
Transcript: ENSMUST00000116586
AA Change: G157S
SMART Domains Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516
AA Change: G157S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 330 402 1.3e-11 SMART
IGc2 434 499 3.73e-12 SMART
FN3 526 608 1.42e-15 SMART
FN3 640 725 3.54e-2 SMART
FN3 740 827 6.15e-11 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 1044 1069 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117200
AA Change: G1135S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: G1135S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117785
AA Change: G1177S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: G1177S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138852
AA Change: G100S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000226478
AA Change: G1181S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000231426
Predicted Effect unknown
Transcript: ENSMUST00000231889
AA Change: G461S
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 R111H probably damaging Het
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Foxd2 C A 4: 114,908,505 G106V unknown Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 T267K probably benign Het
Mfsd8 A G 3: 40,832,011 probably null Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 probably null Het
Olfr530 T G 7: 140,373,253 Y119S probably damaging Het
Otx1 T C 11: 21,996,457 probably benign Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Ppp6r1 T C 7: 4,643,377 T136A possibly damaging Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wdr20 A T 12: 110,794,102 H474L probably benign Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp462 G A 4: 55,023,573 A2121T probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73961700 missense probably benign
IGL00849:Robo2 APN 16 73973777 missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73985691 missense probably damaging 0.98
IGL00944:Robo2 APN 16 73933697 missense possibly damaging 0.92
IGL00955:Robo2 APN 16 74015972 missense probably damaging 1.00
IGL00970:Robo2 APN 16 73897046 missense probably benign 0.00
IGL01020:Robo2 APN 16 73928151 missense probably benign 0.06
IGL01347:Robo2 APN 16 74352856 missense probably damaging 1.00
IGL02280:Robo2 APN 16 74046816 missense probably damaging 1.00
IGL02424:Robo2 APN 16 73973301 missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73956492 missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74055954 intron probably benign
P0018:Robo2 UTSW 16 74046806 missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73956637 missense probably damaging 1.00
R0324:Robo2 UTSW 16 73967851 missense probably damaging 1.00
R0539:Robo2 UTSW 16 73985574 splice site probably benign
R0620:Robo2 UTSW 16 73967802 missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73916205 missense probably benign 0.05
R0701:Robo2 UTSW 16 74046874 missense probably damaging 1.00
R1155:Robo2 UTSW 16 74035108 missense probably damaging 1.00
R1168:Robo2 UTSW 16 73948296 missense probably damaging 1.00
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1317:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1422:Robo2 UTSW 16 73978448 missense probably damaging 0.99
R1452:Robo2 UTSW 16 73961910 missense probably damaging 1.00
R1649:Robo2 UTSW 16 73899001 missense probably benign 0.36
R1709:Robo2 UTSW 16 73956523 missense possibly damaging 0.83
R1751:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1761:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1885:Robo2 UTSW 16 73916145 missense probably benign 0.00
R1911:Robo2 UTSW 16 73958325 missense probably damaging 1.00
R1919:Robo2 UTSW 16 73899154 missense probably benign
R2005:Robo2 UTSW 16 73933115 missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73961888 missense probably damaging 1.00
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3913:Robo2 UTSW 16 74035005 missense probably damaging 1.00
R3956:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R4394:Robo2 UTSW 16 73948379 missense probably benign 0.13
R4426:Robo2 UTSW 16 73948266 missense probably damaging 1.00
R4437:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74352519 intron probably benign
R4478:Robo2 UTSW 16 74015873 missense probably damaging 1.00
R4586:Robo2 UTSW 16 73961873 missense probably damaging 0.96
R4621:Robo2 UTSW 16 73985933 missense probably benign 0.00
R4673:Robo2 UTSW 16 73904378 splice site probably null
R4798:Robo2 UTSW 16 74352745 missense probably damaging 1.00
R4812:Robo2 UTSW 16 73916288 missense probably benign 0.00
R4855:Robo2 UTSW 16 73971191 missense probably damaging 1.00
R4910:Robo2 UTSW 16 73933778 missense probably damaging 0.99
R4916:Robo2 UTSW 16 73898915 missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74352838 missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73973785 missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5447:Robo2 UTSW 16 73973766 nonsense probably null
R5542:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5545:Robo2 UTSW 16 73961747 missense probably damaging 1.00
R5646:Robo2 UTSW 16 73961819 missense probably damaging 0.99
R5734:Robo2 UTSW 16 74352784 missense probably damaging 1.00
R5892:Robo2 UTSW 16 73895780 utr 3 prime probably benign
R5960:Robo2 UTSW 16 73933715 missense probably damaging 1.00
R6130:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6153:Robo2 UTSW 16 73920729 missense probably damaging 1.00
R6240:Robo2 UTSW 16 73982139 missense probably damaging 1.00
R6247:Robo2 UTSW 16 73967784 missense probably damaging 1.00
R6304:Robo2 UTSW 16 73958308 missense probably damaging 1.00
R6337:Robo2 UTSW 16 73928151 missense probably benign 0.06
R6431:Robo2 UTSW 16 74046809 nonsense probably null
R6440:Robo2 UTSW 16 73916122 missense probably benign 0.31
R6596:Robo2 UTSW 16 73971108 missense probably damaging 1.00
R6919:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R6927:Robo2 UTSW 16 73982058 missense probably damaging 1.00
R7029:Robo2 UTSW 16 73948337 missense probably damaging 1.00
R7078:Robo2 UTSW 16 74352616 missense probably damaging 1.00
R7092:Robo2 UTSW 16 73956643 missense probably damaging 0.99
R7136:Robo2 UTSW 16 73956550 missense probably damaging 0.99
X0063:Robo2 UTSW 16 74045828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGCCATTGGTTTATGG -3'
(R):5'- ACAAACTGAGGAACCTTTTACGAAC -3'

Sequencing Primer
(F):5'- CCATTGGTTTATGGAGGATATTTACC -3'
(R):5'- CTGAGGAACCTTTTACGAACACTTG -3'
Posted On2017-10-10