Incidental Mutation 'R6127:Pold1'
ID487446
Institutional Source Beutler Lab
Gene Symbol Pold1
Ensembl Gene ENSMUSG00000038644
Gene Namepolymerase (DNA directed), delta 1, catalytic subunit
Synonyms125kDa
MMRRC Submission 044274-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R6127 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44532746-44548849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44542121 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 147 (Y147C)
Ref Sequence ENSEMBL: ENSMUSP00000117157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049343] [ENSMUST00000145956] [ENSMUST00000151793]
Predicted Effect probably damaging
Transcript: ENSMUST00000049343
AA Change: Y147C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039776
Gene: ENSMUSG00000038644
AA Change: Y147C

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 2.53e-161 SMART
Blast:POLBc 790 837 1e-18 BLAST
Pfam:zf-C4pol 1010 1080 5.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138746
Predicted Effect probably damaging
Transcript: ENSMUST00000145956
AA Change: Y147C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117844
Gene: ENSMUSG00000038644
AA Change: Y147C

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 2e-8 BLAST
PDB:3IAY|A 76 151 7e-8 PDB
SCOP:d1tgoa1 117 153 3e-10 SMART
Blast:POLBc 130 153 7e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000151793
AA Change: Y147C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117157
Gene: ENSMUSG00000038644
AA Change: Y147C

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 66 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 7.8e-164 SMART
Blast:POLBc 790 837 1e-18 BLAST
low complexity region 914 938 N/A INTRINSIC
low complexity region 959 980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208368
Meta Mutation Damage Score 0.566 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have an elevated mutation rate as well as an increased incidence of tumors. Median age for these mice is around 10 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003F12Rik A G 2: 154,549,589 E92G probably damaging Het
4931429L15Rik T A 9: 46,308,922 D104V probably damaging Het
Actl9 T C 17: 33,433,380 V138A probably benign Het
Agl T A 3: 116,758,329 I1204F probably damaging Het
Akna G T 4: 63,368,119 T1381N possibly damaging Het
Atm A C 9: 53,524,509 L167W probably damaging Het
Atp2b2 C T 6: 113,813,877 E189K probably damaging Het
Bend7 A G 2: 4,763,277 D348G probably damaging Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Carmil1 T C 13: 24,036,352 T726A probably benign Het
Csmd3 T A 15: 47,650,228 I2829F probably damaging Het
Ddx50 A T 10: 62,621,563 probably null Het
Epha5 T G 5: 84,071,094 K937N probably damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fuca1 T A 4: 135,934,811 I350N probably damaging Het
Hagh G T 17: 24,861,004 M152I probably damaging Het
Hexdc T C 11: 121,216,999 V185A possibly damaging Het
Ireb2 A G 9: 54,882,368 T109A probably benign Het
Kcnh2 A G 5: 24,325,003 Y702H probably damaging Het
Leng1 G A 7: 3,662,867 P157L probably damaging Het
Maea C T 5: 33,335,518 probably benign Het
Mertk G T 2: 128,738,291 V222F probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Muc13 G A 16: 33,798,947 A22T unknown Het
Muc16 T A 9: 18,657,878 H1115L unknown Het
Olfr1156 T A 2: 87,949,361 S291C probably damaging Het
Olfr1389 C A 11: 49,430,806 T110K probably damaging Het
Olfr291 T A 7: 84,857,202 L278M probably damaging Het
Olfr816 A G 10: 129,911,415 Y288H probably damaging Het
Pak7 G A 2: 136,087,406 P619L probably damaging Het
Pcdh17 A G 14: 84,533,060 K993E probably damaging Het
Pcdhga3 A T 18: 37,674,704 Q70L probably damaging Het
Pcdhgb5 C A 18: 37,732,879 R576S probably damaging Het
Prag1 T C 8: 36,147,401 L1369P unknown Het
Psg29 T A 7: 17,211,746 F414I probably benign Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Rp1 C A 1: 4,349,311 S526I possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setd7 G A 3: 51,530,081 T251I probably damaging Het
Slc25a41 T A 17: 57,034,914 Y145F probably damaging Het
Stag1 T C 9: 100,951,697 V1121A probably benign Het
Svip T C 7: 52,003,453 T38A probably benign Het
Tacc2 A T 7: 130,626,115 H1510L possibly damaging Het
Trav19 A G 14: 53,845,542 T25A probably benign Het
Trip4 A T 9: 65,866,470 probably null Het
Tulp1 T A 17: 28,356,150 H447L probably benign Het
Vmn1r200 A T 13: 22,395,203 T59S probably benign Het
Vmn2r51 A T 7: 10,105,631 L10H probably damaging Het
Wee2 T C 6: 40,449,767 Y157H probably damaging Het
Xrn1 T C 9: 95,969,489 S187P probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Pold1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Pold1 APN 7 44543232 splice site probably benign
IGL01626:Pold1 APN 7 44533372 critical splice donor site probably null
IGL01635:Pold1 APN 7 44535977 missense probably damaging 1.00
IGL02165:Pold1 APN 7 44538060 missense probably damaging 1.00
IGL02197:Pold1 APN 7 44542239 missense probably benign 0.07
IGL02579:Pold1 APN 7 44543279 missense probably damaging 1.00
IGL03104:Pold1 APN 7 44540580 missense probably damaging 1.00
IGL03118:Pold1 APN 7 44539400 missense probably benign 0.17
PIT4243001:Pold1 UTSW 7 44542158 missense possibly damaging 0.77
PIT4431001:Pold1 UTSW 7 44538894 missense probably damaging 1.00
R0184:Pold1 UTSW 7 44541715 missense probably benign 0.32
R0266:Pold1 UTSW 7 44541025 splice site probably benign
R0537:Pold1 UTSW 7 44535092 missense probably damaging 1.00
R1251:Pold1 UTSW 7 44535051 missense probably benign 0.02
R1348:Pold1 UTSW 7 44534682 missense probably benign 0.00
R1376:Pold1 UTSW 7 44540562 missense probably damaging 1.00
R1376:Pold1 UTSW 7 44540562 missense probably damaging 1.00
R1445:Pold1 UTSW 7 44542757 splice site probably benign
R2156:Pold1 UTSW 7 44539118 missense probably damaging 1.00
R2256:Pold1 UTSW 7 44533799 critical splice acceptor site probably null
R2259:Pold1 UTSW 7 44541484 splice site probably benign
R2870:Pold1 UTSW 7 44543347 synonymous silent
R3793:Pold1 UTSW 7 44541570 missense probably damaging 1.00
R4493:Pold1 UTSW 7 44537708 missense probably damaging 1.00
R4583:Pold1 UTSW 7 44538913 missense probably damaging 0.97
R4661:Pold1 UTSW 7 44532809 missense probably damaging 0.99
R4738:Pold1 UTSW 7 44541329 missense probably damaging 0.99
R4769:Pold1 UTSW 7 44535071 missense probably damaging 1.00
R4797:Pold1 UTSW 7 44541901 missense possibly damaging 0.91
R5009:Pold1 UTSW 7 44533902 missense probably benign 0.13
R5150:Pold1 UTSW 7 44535832 missense possibly damaging 0.91
R5534:Pold1 UTSW 7 44538619 missense probably damaging 1.00
R5988:Pold1 UTSW 7 44540580 missense probably damaging 1.00
R6113:Pold1 UTSW 7 44537700 missense probably damaging 1.00
R6232:Pold1 UTSW 7 44540842 critical splice donor site probably null
R6435:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6436:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6437:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6930:Pold1 UTSW 7 44542206 missense probably benign
R7049:Pold1 UTSW 7 44541371 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATAGCTCTATTGCCAGCACTG -3'
(R):5'- CAGTGACATCCTTCAGTGTGG -3'

Sequencing Primer
(F):5'- TGAGAGCTCCTTCCCACCG -3'
(R):5'- TTCAGTGTGGCCTCCGGTC -3'
Posted On2017-10-10