Incidental Mutation 'R6129:Cyp27a1'
ID487552
Institutional Source Beutler Lab
Gene Symbol Cyp27a1
Ensembl Gene ENSMUSG00000026170
Gene Namecytochrome P450, family 27, subfamily a, polypeptide 1
Synonymscholesterol 27 hydroxylase, Cyp27, 1300013A03Rik
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74713574-74737892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74735692 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 264 (R264H)
Ref Sequence ENSEMBL: ENSMUSP00000027356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027356] [ENSMUST00000081636] [ENSMUST00000113672] [ENSMUST00000160732] [ENSMUST00000188073]
Predicted Effect probably benign
Transcript: ENSMUST00000027356
AA Change: R264H

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027356
Gene: ENSMUSG00000026170
AA Change: R264H

DomainStartEndE-ValueType
Pfam:p450 63 529 5.1e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081636
SMART Domains Protein: ENSMUSP00000080342
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113672
SMART Domains Protein: ENSMUSP00000109302
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
CBS 177 226 2.66e-6 SMART
CBS 258 307 7.57e-11 SMART
CBS 333 381 8.69e-11 SMART
CBS 405 453 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160732
SMART Domains Protein: ENSMUSP00000125344
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188073
SMART Domains Protein: ENSMUSP00000139909
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190781
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This mitochondrial protein oxidizes cholesterol intermediates as part of the bile synthesis pathway. Since the conversion of cholesterol to bile acids is the major route for removing cholesterol from the body, this protein is important for overall cholesterol homeostasis. Mutations in this gene cause cerebrotendinous xanthomatosis, a rare autosomal recessive lipid storage disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null allele show hepato- and adrenomegaly, reduced bile acid synthesis, increased cholesterol 7alpha-hydroxylase activity and 7alpha-hydroxycholesterol levels, slightly higher 25-hydroxyvitamin D levels, and altered hepatic fatty acid, triacylglycerol, and adrenal cholesterol homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Cyp27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cyp27a1 APN 1 74731938 missense possibly damaging 0.88
IGL01824:Cyp27a1 APN 1 74735881 nonsense probably null
IGL02725:Cyp27a1 APN 1 74735703 missense probably damaging 0.98
IGL02966:Cyp27a1 APN 1 74732090 missense probably benign
IGL03067:Cyp27a1 APN 1 74731909 splice site probably null
R0103:Cyp27a1 UTSW 1 74735915 missense probably benign
R0103:Cyp27a1 UTSW 1 74735915 missense probably benign
R1968:Cyp27a1 UTSW 1 74737276 missense probably benign 0.00
R2271:Cyp27a1 UTSW 1 74736687 missense probably damaging 1.00
R3847:Cyp27a1 UTSW 1 74737559 missense probably damaging 0.99
R4735:Cyp27a1 UTSW 1 74737207 missense possibly damaging 0.94
R4936:Cyp27a1 UTSW 1 74735405 missense probably benign 0.35
R5849:Cyp27a1 UTSW 1 74736684 missense probably damaging 1.00
R6193:Cyp27a1 UTSW 1 74737072 missense probably benign 0.00
R6344:Cyp27a1 UTSW 1 74736849 critical splice donor site probably null
R6464:Cyp27a1 UTSW 1 74735888 missense possibly damaging 0.61
R7226:Cyp27a1 UTSW 1 74737348 missense probably damaging 1.00
R7337:Cyp27a1 UTSW 1 74735435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACCACCTTGCCTTGGAAG -3'
(R):5'- TCCTGCGTGGAAAACAGAAG -3'

Sequencing Primer
(F):5'- AGTCTCGGTCCTCTGGC -3'
(R):5'- AGAGAGTGTGCTTAAACCGCCC -3'
Posted On2017-10-10