Incidental Mutation 'R6129:Mysm1'
ID487562
Institutional Source Beutler Lab
Gene Symbol Mysm1
Ensembl Gene ENSMUSG00000062627
Gene Namemyb-like, SWIRM and MPN domains 1
SynonymsC130067A03Rik, C530050H10Rik
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location94942040-94979100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94967955 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 135 (R135L)
Ref Sequence ENSEMBL: ENSMUSP00000075269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075872]
Predicted Effect probably damaging
Transcript: ENSMUST00000075872
AA Change: R135L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075269
Gene: ENSMUSG00000062627
AA Change: R135L

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
SANT 114 162 3.24e-13 SMART
low complexity region 214 229 N/A INTRINSIC
Pfam:SWIRM 365 452 3.1e-22 PFAM
JAB_MPN 569 691 1.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155935
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Homozygotes exhibit pigmentation, epidermis, hair follicle and hair cycle abnormalities. Abnormalities in behavior, the hematopoietic and immune systems, body size, metabolism, and skeletal and eye phenotypes are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Mysm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Mysm1 APN 4 94972909 splice site probably benign
IGL00657:Mysm1 APN 4 94960365 missense probably benign 0.17
IGL00908:Mysm1 APN 4 94958935 missense probably damaging 1.00
IGL01095:Mysm1 APN 4 94967869 critical splice donor site probably null
IGL02454:Mysm1 APN 4 94970504 splice site probably benign
IGL02544:Mysm1 APN 4 94952306 missense probably damaging 1.00
IGL02815:Mysm1 APN 4 94957048 critical splice donor site probably null
IGL02966:Mysm1 APN 4 94975286 missense probably benign 0.31
IGL03273:Mysm1 APN 4 94965718 missense probably damaging 1.00
R1746:Mysm1 UTSW 4 94948411 nonsense probably null
R1826:Mysm1 UTSW 4 94970686 missense probably benign 0.01
R1980:Mysm1 UTSW 4 94952213 missense probably benign 0.27
R3424:Mysm1 UTSW 4 94965321 missense probably benign 0.05
R3700:Mysm1 UTSW 4 94970652 missense probably benign 0.04
R4243:Mysm1 UTSW 4 94969011 missense probably benign 0.15
R4798:Mysm1 UTSW 4 94965673 missense probably benign 0.00
R4884:Mysm1 UTSW 4 94958948 missense probably damaging 0.98
R4983:Mysm1 UTSW 4 94972970 missense probably benign 0.01
R5024:Mysm1 UTSW 4 94951016 missense possibly damaging 0.47
R5213:Mysm1 UTSW 4 94948377 missense probably damaging 0.96
R5758:Mysm1 UTSW 4 94952361 missense probably damaging 0.98
R7399:Mysm1 UTSW 4 94961727 missense probably benign 0.29
X0021:Mysm1 UTSW 4 94975225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAACTCTCAGCAGTAAGACTAG -3'
(R):5'- GGGCTTGGATTTTCAACACATAG -3'

Sequencing Primer
(F):5'- CTCTCAGCAGTAAGACTAGTTAGCTG -3'
(R):5'- TAATGTGGCAGCTGCTTG -3'
Posted On2017-10-10