Incidental Mutation 'R6129:Csmd2'
ID487563
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128493334 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 2141 (G2141S)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148247
Predicted Effect possibly damaging
Transcript: ENSMUST00000184063
AA Change: G2141S

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
Predicted Primers PCR Primer
(F):5'- ATTGTACCAAGGGCTCCACAG -3'
(R):5'- GCCGGTAATAATAGGATGCTGTG -3'

Sequencing Primer
(F):5'- AGGGCTCCACAGATGCCATTG -3'
(R):5'- GTTTCTATGACTACCCCAGGAAGG -3'
Posted On2017-10-10