Incidental Mutation 'R6129:Fbxo6'
ID487564
Institutional Source Beutler Lab
Gene Symbol Fbxo6
Ensembl Gene ENSMUSG00000055401
Gene NameF-box protein 6
SynonymsFbx6b, FBG2, Fbs2, Fbxo6b
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6129 (G1)
Quality Score224.009
Status Validated
Chromosome4
Chromosomal Location148145716-148152140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148149522 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 39 (I39N)
Ref Sequence ENSEMBL: ENSMUSP00000130188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030858] [ENSMUST00000030860] [ENSMUST00000056965] [ENSMUST00000057907] [ENSMUST00000084129] [ENSMUST00000105705] [ENSMUST00000105706] [ENSMUST00000105707] [ENSMUST00000126615] [ENSMUST00000129253] [ENSMUST00000132083] [ENSMUST00000132698] [ENSMUST00000134261] [ENSMUST00000140049] [ENSMUST00000151246] [ENSMUST00000152098] [ENSMUST00000167160] [ENSMUST00000168503] [ENSMUST00000172472]
Predicted Effect probably damaging
Transcript: ENSMUST00000030858
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030858
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030860
SMART Domains Protein: ENSMUSP00000030860
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 12 184 1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056965
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062348
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057907
SMART Domains Protein: ENSMUSP00000054022
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084129
SMART Domains Protein: ENSMUSP00000081146
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 13 167 4.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105705
SMART Domains Protein: ENSMUSP00000101330
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 196 2.79e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105706
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101331
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105707
SMART Domains Protein: ENSMUSP00000101332
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 13 171 4.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105708
Predicted Effect probably damaging
Transcript: ENSMUST00000126615
AA Change: I39N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120801
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 237 1.39e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129253
SMART Domains Protein: ENSMUSP00000117013
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 213 1.15e-57 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132083
AA Change: I39N
SMART Domains Protein: ENSMUSP00000120431
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132698
SMART Domains Protein: ENSMUSP00000122774
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 12 168 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134261
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123132
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 228 1.89e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140049
SMART Domains Protein: ENSMUSP00000120481
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
PDB:4FJO|C 32 107 1e-47 PDB
SCOP:d1go4a_ 32 107 1e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151246
SMART Domains Protein: ENSMUSP00000114571
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 231 1.43e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152098
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121379
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153703
SMART Domains Protein: ENSMUSP00000115937
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBA 1 143 3.11e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167160
SMART Domains Protein: ENSMUSP00000126551
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168503
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130188
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172472
SMART Domains Protein: ENSMUSP00000133966
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 126 3.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183749
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class, and its C-terminal region is highly similar to that of rat NFB42 (neural F Box 42 kDa) which may be involved in the control of the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Fbxo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Fbxo6 APN 4 148146143 missense probably damaging 1.00
IGL00940:Fbxo6 APN 4 148146110 missense probably benign 0.05
IGL02996:Fbxo6 APN 4 148146891 missense probably damaging 1.00
IGL03034:Fbxo6 APN 4 148146122 nonsense probably null
R0556:Fbxo6 UTSW 4 148146175 missense probably damaging 1.00
R1475:Fbxo6 UTSW 4 148146110 missense probably benign 0.05
R1482:Fbxo6 UTSW 4 148145984 nonsense probably null
R1986:Fbxo6 UTSW 4 148146095 missense probably damaging 1.00
R3742:Fbxo6 UTSW 4 148149633 unclassified probably benign
R4994:Fbxo6 UTSW 4 148149491 missense probably damaging 0.99
R6102:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6103:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6104:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6105:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6130:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6212:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6220:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6392:Fbxo6 UTSW 4 148146005 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGACATTTGTCGTTAGCTAGC -3'
(R):5'- TTCAGGTCCTCAGCTCACTG -3'

Sequencing Primer
(F):5'- TAAAGAAGGCTCCCAGGGCTC -3'
(R):5'- AGGTCCTCAGCTCACTGTCTTC -3'
Posted On2017-10-10