Incidental Mutation 'R6129:Robo3'
ID487576
Institutional Source Beutler Lab
Gene Symbol Robo3
Ensembl Gene ENSMUSG00000032128
Gene Nameroundabout guidance receptor 3
SynonymsRig1, Rig-1, Robo3b, Robo3a, Rbig1
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37415669-37433246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37423293 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 592 (Y592H)
Ref Sequence ENSEMBL: ENSMUSP00000150639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000115038] [ENSMUST00000170512]
Predicted Effect probably benign
Transcript: ENSMUST00000034643
AA Change: Y592H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128
AA Change: Y592H

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115038
AA Change: Y614H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128
AA Change: Y614H

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167216
Predicted Effect probably benign
Transcript: ENSMUST00000170512
AA Change: Y592H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171467
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Roundabout (ROBO) gene family that controls neurite outgrowth, growth cone guidance, and axon fasciculation. ROBO proteins are a subfamily of the immunoglobulin transmembrane receptor superfamily. SLIT proteins 1-3, a family of secreted chemorepellants, are ligands for ROBO proteins and SLIT/ROBO interactions regulate myogenesis, leukocyte migration, kidney morphogenesis, angiogenesis, and vasculogenesis in addition to neurogenesis. This gene, ROBO3, has a putative extracellular domain with five immunoglobulin (Ig)-like loops and three fibronectin (Fn) type III motifs, a transmembrane segment, and a cytoplasmic tail with three conserved signaling motifs: CC0, CC2, and CC3 (CC for conserved cytoplasmic). Unlike other ROBO family members, ROBO3 lacks motif CC1. The ROBO3 gene regulates axonal navigation at the ventral midline of the neural tube. In mouse, loss of Robo3 results in a complete failure of commissural axons to cross the midline throughout the spinal cord and the hindbrain. Mutations ROBO3 result in horizontal gaze palsy with progressive scoliosis (HGPPS); an autosomal recessive disorder characterized by congenital absence of horizontal gaze, progressive scoliosis, and failure of the corticospinal and somatosensory axon tracts to cross the midline in the medulla. Alternative transcript variants have been described but have not been experimentally validated. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutants display perinatal lethality, abnormal commissural axon growth, and fragile floor plates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Robo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Robo3 APN 9 37427754 critical splice donor site probably null
IGL01023:Robo3 APN 9 37429551 missense probably damaging 1.00
IGL01431:Robo3 APN 9 37419111 unclassified probably benign
IGL01993:Robo3 APN 9 37424653 missense probably damaging 1.00
IGL02256:Robo3 APN 9 37425353 missense probably damaging 1.00
IGL02323:Robo3 APN 9 37422201 missense probably benign 0.05
IGL02561:Robo3 APN 9 37427091 missense possibly damaging 0.84
IGL02866:Robo3 APN 9 37422306 missense possibly damaging 0.89
IGL02897:Robo3 APN 9 37427502 nonsense probably null
IGL03003:Robo3 APN 9 37419291 missense probably damaging 1.00
IGL03307:Robo3 APN 9 37422564 missense probably damaging 0.96
IGL03097:Robo3 UTSW 9 37422528 critical splice donor site probably null
R0137:Robo3 UTSW 9 37425344 missense probably benign 0.00
R0266:Robo3 UTSW 9 37422640 missense probably damaging 0.96
R0390:Robo3 UTSW 9 37422177 missense probably benign 0.00
R0505:Robo3 UTSW 9 37416759 unclassified probably benign
R0815:Robo3 UTSW 9 37422183 missense probably damaging 1.00
R0924:Robo3 UTSW 9 37429482 splice site probably benign
R1167:Robo3 UTSW 9 37423907 nonsense probably null
R1203:Robo3 UTSW 9 37418682 missense probably damaging 1.00
R1451:Robo3 UTSW 9 37417711 missense probably benign 0.01
R1575:Robo3 UTSW 9 37429661 missense probably damaging 1.00
R1596:Robo3 UTSW 9 37424632 critical splice donor site probably null
R1660:Robo3 UTSW 9 37429144 missense probably damaging 1.00
R1677:Robo3 UTSW 9 37417709 missense possibly damaging 0.75
R1839:Robo3 UTSW 9 37422327 missense probably benign 0.00
R1878:Robo3 UTSW 9 37422165 missense probably damaging 1.00
R1891:Robo3 UTSW 9 37428055 missense probably damaging 1.00
R2040:Robo3 UTSW 9 37427464 missense probably damaging 1.00
R2859:Robo3 UTSW 9 37428104 nonsense probably null
R3786:Robo3 UTSW 9 37422225 missense probably damaging 1.00
R3886:Robo3 UTSW 9 37422181 nonsense probably null
R3888:Robo3 UTSW 9 37422181 nonsense probably null
R3910:Robo3 UTSW 9 37419295 missense probably damaging 1.00
R4212:Robo3 UTSW 9 37421898 missense probably damaging 1.00
R4213:Robo3 UTSW 9 37421898 missense probably damaging 1.00
R4691:Robo3 UTSW 9 37425218 missense probably damaging 0.99
R4979:Robo3 UTSW 9 37423344 missense probably damaging 1.00
R5238:Robo3 UTSW 9 37416879 missense probably damaging 0.99
R5570:Robo3 UTSW 9 37425275 missense possibly damaging 0.81
R5629:Robo3 UTSW 9 37419211 nonsense probably null
R5770:Robo3 UTSW 9 37419201 missense possibly damaging 0.87
R5837:Robo3 UTSW 9 37429816 critical splice acceptor site probably null
R6021:Robo3 UTSW 9 37422533 nonsense probably null
R6232:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6233:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6235:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6326:Robo3 UTSW 9 37427027 missense probably damaging 1.00
R6354:Robo3 UTSW 9 37417217 unclassified probably benign
R6355:Robo3 UTSW 9 37418939 missense possibly damaging 0.71
R6475:Robo3 UTSW 9 37423290 missense probably damaging 0.99
R6937:Robo3 UTSW 9 37429880 missense probably benign 0.16
R7201:Robo3 UTSW 9 37424330 nonsense probably null
R7208:Robo3 UTSW 9 37424724 missense probably damaging 0.99
R7249:Robo3 UTSW 9 37424833 missense probably benign
R7376:Robo3 UTSW 9 37432916 missense probably damaging 1.00
R7380:Robo3 UTSW 9 37418556 missense probably damaging 1.00
R7448:Robo3 UTSW 9 37424815 missense possibly damaging 0.89
R7475:Robo3 UTSW 9 37425378 missense probably benign 0.01
X0024:Robo3 UTSW 9 37427855 missense probably damaging 1.00
X0027:Robo3 UTSW 9 37427825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTGCCACCATTCTGTG -3'
(R):5'- GATCCTATGTCCTTAGGGCCTTTG -3'

Sequencing Primer
(F):5'- CCATTCTGTGGTTTGGATGGG -3'
(R):5'- AGGGCCTTTGCTATTTTGGAATAATG -3'
Posted On2017-10-10