Incidental Mutation 'R6129:Pcbp3'
ID487578
Institutional Source Beutler Lab
Gene Symbol Pcbp3
Ensembl Gene ENSMUSG00000001120
Gene Namepoly(rC) binding protein 3
SynonymsAlphaCP-3
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location76761857-76961887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76763348 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 318 (E318G)
Ref Sequence ENSEMBL: ENSMUSP00000129465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001148] [ENSMUST00000092393] [ENSMUST00000105411] [ENSMUST00000168465]
Predicted Effect probably damaging
Transcript: ENSMUST00000001148
AA Change: E318G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001148
Gene: ENSMUSG00000001120
AA Change: E318G

DomainStartEndE-ValueType
KH 44 112 4.66e-17 SMART
KH 128 199 2.08e-14 SMART
KH 292 362 1.77e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092393
SMART Domains Protein: ENSMUSP00000090048
Gene: ENSMUSG00000001120

DomainStartEndE-ValueType
KH 12 80 4.66e-17 SMART
KH 96 167 2.08e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105411
AA Change: E317G

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101051
Gene: ENSMUSG00000001120
AA Change: E317G

DomainStartEndE-ValueType
KH 44 112 4.66e-17 SMART
KH 128 199 2.08e-14 SMART
KH 291 361 1.77e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168240
Predicted Effect probably damaging
Transcript: ENSMUST00000168465
AA Change: E318G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129465
Gene: ENSMUSG00000001120
AA Change: E318G

DomainStartEndE-ValueType
KH 44 112 4.66e-17 SMART
KH 128 199 2.08e-14 SMART
KH 292 362 1.77e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168505
Predicted Effect unknown
Transcript: ENSMUST00000173854
AA Change: E107G
SMART Domains Protein: ENSMUSP00000134144
Gene: ENSMUSG00000001120
AA Change: E107G

DomainStartEndE-ValueType
Blast:KH 8 63 4e-27 BLAST
KH 82 152 1.77e-17 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KH-domain protein subfamily. Proteins of this subfamily, also referred to as alpha-CPs, bind to RNA with a specificity for C-rich pyrimidine regions. Alpha-CPs play important roles in post-transcriptional activities and have different cellular distributions. The protein encoded by this gene lacks the nuclear localization signals found in other subfamily members. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Pcbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01641:Pcbp3 APN 10 76767857 splice site probably benign
R1294:Pcbp3 UTSW 10 76763321 missense probably damaging 1.00
R2101:Pcbp3 UTSW 10 76789755 missense possibly damaging 0.71
R4324:Pcbp3 UTSW 10 76763343 nonsense probably null
R4675:Pcbp3 UTSW 10 76771035 missense possibly damaging 0.94
Z1088:Pcbp3 UTSW 10 76763323 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CTGTATCAGTCAGGCTGTGG -3'
(R):5'- TCAGGACTTTGCAGTGCCTG -3'

Sequencing Primer
(F):5'- GGGCTGCGAGTCATAGCTAG -3'
(R):5'- CTTTCCAGAGCGCTGAGTTCATAG -3'
Posted On2017-10-10